1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ella [17]
3 years ago
7

Someone help me pleaseeee

Biology
1 answer:
sertanlavr [38]3 years ago
7 0

The answer is C, I believe. A dominant trait is one that the offspring is more likely to get, as opposed to a recessive trait, which the dominant trait "masks" over.

You might be interested in
The first step of the scientific method usually involves _______.
asambeis [7]

Answer:

b. developing a hypothesis

3 0
2 years ago
An experiment you could run to test the Evolution theory?
lara31 [8.8K]
“The test of any theory is whether or not it provides answers to basic questions. Some well-meaning but misguided people think evolution is a reasonable theory to explain man’s questions about the universe.”Where did the space for the universe come from? Witch can be experimented to answer.
3 0
1 year ago
_______________ break down nutrients to get usable energy.
Kay [80]
Mitpchondria, I hope I helped,Can I have brainliest!
7 0
3 years ago
Can anyone help me please?
Lana71 [14]

Answer:

I think the answer is 2 or 1

Explanation:

(so sorry if im wrong)

5 0
2 years ago
An organism's scientific name consist of
Colt1911 [192]
The genus and the Species
6 0
3 years ago
Read 2 more answers
Other questions:
  • Overuse of resources is a serious issue that will affect generations to come. Identify which practice is NOT being used, or rese
    12·2 answers
  • Eversion is performed by which of the following muscles?
    6·1 answer
  • 1. Which of the following is an accurate description of mitosis and meiosis? A. Mitosis produces two diploid daughter cells, whi
    13·2 answers
  • in which mode of reproduction do embryos develop inside the mother’s body using an egg yolk for nourishment ?
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why does the body produce more urine on a cold day rather than a hot day if the same amount of
    11·1 answer
  • If mRNA had the codon GUA, what amino acid does that code for?
    10·1 answer
  • HELLPPPP ITS THE HIGHLIGHTED ONE
    12·2 answers
  • Environmental factors typically activate genes in a cell by causing the cell to --
    7·1 answer
  • Enter a nuclear equation for the fusion of two h-2 atoms to form he-3 and one neutron. express your answer as a nuclear equation
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!