1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
3 years ago
9

What are fossils? Please help.

Biology
2 answers:
Zepler [3.9K]3 years ago
4 0

Answer: old bones of animals/mammals that’s are extinct

Explanation: plz give brainlest

m_a_m_a [10]3 years ago
4 0
Fossils are preserved remains/traces/marks of an animal that lived millions of years ago. Some stuff that are found as fossils include shells and bones (since they are hard materials). Fossils can also be found trapped in sap/amber.
You might be interested in
How do chemical companies contribute to acid deposition in the environment?
steposvetlana [31]

stems and leaves

roots and stem

leaves and roots

6 0
4 years ago
Plants are natures___________ conditioners ​
Lesechka [4]

Answer:

air conditioners

Explanation:

Oxygen is always released from higher plants during photosynthesis

3 0
3 years ago
How can a bias affect the application of science in society
boyakko [2]
Scientists are humans, too, so they have likes and dislikes. They may think different things or promote different things based on their different views
7 0
3 years ago
Consider the scenario in which Mutants A and B are grown in a medium that contains His, but does not contain Trp. For this scena
solmaris [256]

Answer: Attached below is the missing part of your question

answer

Mutant A

<em>1) Requires tryptophan in the growth medium or from a donor mutant </em>

<em>2) Must form nanotubes to obtain it's required amino acid in this scenario:</em>

Mutant B

<em>1) Requires histidine in the growth medium or from a donor mutant </em>

<em>2) Does not need to form nanotubes to obtain it's required amino acid in this scenario:</em>

Explanation:

<u>Mutant A ( Over produces His and cannot produce Trp ) </u>

1) Requires tryptophan in the growth medium or from a donor mutant ; This is because the Mutant is an auxotroph for tryptophan.

2) Must form nanotubes to obtain it's required amino acid in this scenario:

This is because growth medium of the mutant is supplemented with  histidine

<u>Mutant B ( cannot produce His and overproduces Trp </u>)

1) Requires histidine in the growth medium or from a donor mutant :

This is because Mutant B lacks the biosynthetic pathways necessary for histidine production

2) Does not need to form nanotubes to obtain it's required amino acid in this scenario: because the Mutant cell can easily take up the required amount of Histidine from its surroundings.

3 0
3 years ago
What are sugars such as glucose, fructose, and ribose examples of?
vladimir2022 [97]
I believe they can be categorized as simple sugars and or monosaccharides.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the difference between asexual and sexual reproduction?
    15·1 answer
  • 5. The largest mass extinction event in the history of the Earth occurred at the end of the _______ period. A. Devonian B. Ordov
    11·1 answer
  • Scientists have a great deal of responsibility. Why is it important for scientists to communicate their results accurately to pe
    10·1 answer
  • Aminoglycosides: Select one: a. attach to the 30S ribosomal subunit and disrupt protein synthesis. b. are metabolic analogs of P
    7·1 answer
  • 2. The Isthmus of Panama cut off gene flow between Atlantic and Pacific populations of a species of fish. The cessation of gene
    15·1 answer
  • Which of the following is most important in forming ATP
    13·2 answers
  • What percentage of mass of human body is made up of oxygen
    5·2 answers
  • Which of the following statements are true? Select all that apply.
    11·1 answer
  • Match each gymnosperm to its correct description. plzzz help me reeee​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!