1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
3 years ago
10

among the effects of radiation exposure on humans is the initiation of cancer and damage to rapidly growing cells,such as skin c

ells For what reason would the effect be more evident in more active cells?​
Biology
1 answer:
Sergeeva-Olga [200]3 years ago
4 0

Answer:

idek

Explanation:

You might be interested in
Choose all the answers that apply. Evolution _____. happens slowly over time is any change in the DNA of an organism only occurs
xxMikexx [17]

Answer: The Answers are, A: happens all the time, D: can be caused by genetic drift, and E: can be caused by natural selection.

6 0
4 years ago
Give an example of genetic biodiversity
Ira Lisetskai [31]
Woody plants i guess
6 0
3 years ago
Read 2 more answers
What is the sciatic notch? How can it be used to determine gender?
Ivahew [28]

Answer:

a sciatic notch is a part of the pelvis.

Men have a more arched sciatic notch while women have a broader sciatic notch

Explanation:

Various measurements of the greater sciatic notch such as width, depth, and length of the posterior angles.

The demarking points identify sex with 100% accuracy.

Hope this helps :)

7 0
3 years ago
HELP NEEDED
Nuetrik [128]
A) be unable to maintain homeostasis
7 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • The effects of electrical stimulation to the sciatic nerve ________
    5·1 answer
  • Mutations occur when segments of DNA are accidentally rearranged through the deletion, insertion, or substitution of one or more
    8·2 answers
  • Which domains contain organisms that lack a membrane-bound nucleus?a. Archaea &amp; Bacteria b. Archaea &amp; Eukaryac. Bacteria
    8·1 answer
  • The cances are 50/50 because if it snowe tonight that means tjat the ir up in the sky has become freezing and ifball of the snow
    14·1 answer
  • Zoom in to see better but I have no idea what the answer is can someone help
    8·1 answer
  • What are auroras made of?
    8·1 answer
  • Which phase of sex cell production results in homologous pairs of chromosomes forming? prophase I of meiosis anaphase II telopha
    6·2 answers
  • What is the definition of adenine
    15·2 answers
  • Name two types of a sexual
    9·2 answers
  • How are acids and protons related? (1 point)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!