1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
2 years ago
5

Which of these scenarios is an example of natural selection?

Biology
1 answer:
GaryK [48]2 years ago
3 0

Answer:

C

Explanation:

Natural selection is when an animal with a better trait survives and reproduces.  C is the best answer.

You might be interested in
"when treating a patient who experienced a pulmonary blast injury, you should"
pav-90 [236]
Hi there!

I'm not too sure how to save the victim's life in a situation like this, but you SHOULD NOT give oxygen to a victim who has suffered from an explosion at close-range, while under positive pressure.
3 0
3 years ago
Read 2 more answers
What is the part of your body used as a reference point when adjusting your head restraint to the appropriate height?.
marin [14]

Answer:

your ears

Explanation:

6 0
2 years ago
List one advantage ,disadvantages about sporulation and what kind of organisms do this ?
Anni [7]
Well if you were to ask me 1 is that sporulation can make lots of more plants but i dont know any disadvntages
3 0
3 years ago
A human lost at sea without fresh drinking water is effectively lost in an osmotic desert. why would drinking salt water be harm
Grace [21]
Drinking salt water is harmful because it messes up the salt concentration in each of your red blood cells. It over loads the salt in it and causes the cell to swell up and burst due to it trying to let in more water to balance the salt concentration out. 
4 0
3 years ago
Kip studies flower color in petunias, where the allele for red flowers, R, is dominant to the allele for white flowers, r. If Ki
Doss [256]
What is tRNA involved in?

7 0
3 years ago
Read 2 more answers
Other questions:
  • Ions are necessary to activate the binding sites on the actin filaments.
    11·1 answer
  • Are fungi heterotrophs
    10·2 answers
  • ____________ metamorphic rocks have mineral grains that line up in parallel layers. a. extrusive c. non-foliated b. foliated d.
    5·1 answer
  • Several medicines that treat human diseases have been sourced from plants in tropical rainforests. For example, quinine, which i
    15·2 answers
  • What 2 animals have 2 body structures
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Hello please help i’ll give brainliest
    13·1 answer
  • NASA has proposed a mission to one of Jupiter's moons to look for potential signs of life. The spacecraft will have 9,862.5 Joul
    11·1 answer
  • What is needed in order for scientists to refine and expand on ideas?
    13·1 answer
  • The Truth About Milk Essay! Please read! Rate this from a scale of 1 - 10 and please share! Link leads to petition
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!