1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
3 years ago
15

Explain at least 2 differences between a plant cell and an animal cells.

Biology
2 answers:
AysviL [449]3 years ago
6 0

<u><em>PLEASE MARK ME AS BRAINLIEST</em></u>

Answer:

A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. In contrast, animal cells have many, smaller vacuoles. Plant cells have a cell wall, as well as a cell membrane. ... Animal cells simply have a cell membrane, but no cell wall.

Explanation:

Both animal and plant cells have mitochondria, but only plant cells have chloroplasts. Plants don’t get their sugar from eating food, so they need to make sugar from sunlight. This process (photosynthesis) takes place in the chloroplast. Once the sugar is made, it is then broken down by the mitochondria to make energy for the cell. Because animals get sugar from the food they eat, they do not need chloroplasts: just mitochondria.

Both plant and animal cells have vacuoles. A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. In contrast, animal cells have many, smaller vacuoles.

Plant cells have a cell wall, as well as a cell membrane. In plants, the cell wall surrounds the cell membrane. This gives the plant cell its unique rectangular shape. Animal cells simply have a cell membrane, but no cell wall.

Gemiola [76]3 years ago
3 0

Answer:

Plant cells have a cell wall that covers their cell membrane while animal cells have a cell membrane without a cell wall.

Plant cells do not have a nucleus while animal cells do.

Animal cells have small, tiny vacuoles. Plant cells have one big vacuole

Explanation:

<u>Vocabulary</u>

<em>Cell wall: </em>Strong, rigid structure that supports the cell.

<em>Cell membrane: </em>Controls what goes in and out of the cell.

<em>Nucleous: </em>A cell organism that holds the DNA for a animal or human.

<em>Vacuole: </em>A cell organism that stores nutrients, food, and water for the cell.

Good luck on your test/diagnostic/worksheet!

{I worked hard may I please have Brainliest? <3}

You might be interested in
Which statement must be true of their individuals if two populations are no longer the same species?
Jlenok [28]

Answer:

wouldn't it he A

Explanation:

because they are not the same species

5 0
3 years ago
Plant species A cannot fight most fungal infections, while plant species B makes a protein that kills many fungi.
GREYUIT [131]

Answer:They can insert the gene for the protein from species B into a chromosome in species A.

Explanation:

6 0
3 years ago
Is it possible for water to become "stuck" in a step of the water cycle
brilliants [131]
No, because either way, sometime the water is going to have to become a gas or cloud or something. Also, the water cycle "doesn't end".
7 0
3 years ago
The idea that within-host selection favors higher virulence assumes: Group of answer choices a) more rapidly replicating strains
Tema [17]

Answer:

d) a and c are correct

Explanation:

4 0
4 years ago
What shape would you make if both pushpins were placed at a single central point? What would be the focal length and eccentricit
Darya [45]
If both pins were placed in a single central point, the shape would be a circle. Focal length and eccentricity would be 0
6 0
4 years ago
Other questions:
  • Which nitrogen base binds with adenine?
    13·2 answers
  • If a plant cell contains more solutes than its surrounding environment, what will happen?
    5·1 answer
  • Acording to erikson what is the first stage of psychosocial development?
    6·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • The electrons in the outermost energy level are called........?
    5·2 answers
  • Which of the following sentences contains correct usage of its/it's?
    5·1 answer
  • Although animal nervous systems differ in complexity, their nerve cells are still remarkably similar. true false
    7·1 answer
  • How does adding and removing heat energy to water affect it’s temperature?
    11·1 answer
  • Mentors are often a very important part of a hero’s journey. Who are our mentors today? How has a mentor helped motivate you or
    6·2 answers
  • What does the line of blue triangles mean on a weather map?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!