1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
storchak [24]
3 years ago
15

Indicate how blochemistry provides evidence of evolution.​

Biology
1 answer:
zysi [14]3 years ago
3 0
Complex biochemicals found in diverse species probably did not evolve independently which is how they indicate common industry
You might be interested in
How does the available staff influence the selection of either continuous electronic or intermittent auscultation as the fetal-m
kondaur [170]

Answer:

The options

a. There must be a 1:1 nurse-to-patient ratio regardless of the method used.

b. Staffing patterns do not influence fetal monitoring choices.

c. Use of intermittent auscultation requires a lower nurse-to-patient ratio.

d. More nurses are needed when electronic fetal monitoring is used because of increased medical interventions.

The ANSWER is c.

c. Use of intermittent auscultation requires a lower nurse-to-patient ratio.

Explanation:

a. There must be a 1:1 nurse-to-patient ratio regardless of the method used.❌

A one-to-one ratio is important at the second phase of labor or in occurrence of a high-risk condition, irrespective of the monitoring method applied.

b. Staffing patterns do not influence fetal monitoring choices.❌

Staffing patterns do have an influence in conserving safe monitoring routine of the labor patient.

c. Use of intermittent auscultation requires a lower nurse-to-patient ratio.✔

Intermittent auscultation is largely staff-intensive.

d. More nurses are needed when electronic fetal monitoring is used because of increased medical ❌

Reduced nursing time is needed when carrying out electronic monitoring, this will allow the nurse to have increased time for educating, encouraging and supporting the laboring woman.

6 0
3 years ago
True or False? Many marine organisms depend on estuaries during at least some point of their life.
sineoko [7]

Answer:

False

Explanation:

It is false because it is not true.

Pls mark brainlist

6 0
3 years ago
Read 2 more answers
What are the new cells produced called
kirza4 [7]

Explanation:

New cells are created from a process called cell division. The new cells are produced when a cell, called the mother cell, divides into new cells called daughter cells. When two daughter cells have the same number of chromosomes as the original cell, the process is called mitosis

5 0
3 years ago
How can natural selection affect a predator-prey relationship?
wel
Predators and prey are both in a constant struggle for survival, foxes with bigger ears tend to catch more mice, and live longer, because of this, foxes with smaller ears don't live as long, pretty soon all foxes have larger ears. The same goes for prey, Mice with padded feet live longer due to the foxes having more trouble hearing them, pretty soon all mice have padded feet, and the cycle continues.
8 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • Why are the symptoms of vascular neurocognitive disorder so different in each patient?
    5·1 answer
  • In an ecosystem where the owls eat mice the carrying capacity of both populations has been reached . how would the migration of
    15·1 answer
  • PLZ HELP MEH!!!!!! How does RNA act like a messenger to deliver genetic code information?
    8·2 answers
  • What best describes a theory
    12·1 answer
  • How are models related to theories and hypothesis ?
    7·1 answer
  • Which best explains why water boils in a pot sitting over fire?
    5·1 answer
  • Annabel bought garden lights that are charged by the sun during the day and produced light at night. What is this an example of?
    9·1 answer
  • 30 points The movement of oxygen across the cell membrane is an example of which type of transport?
    11·1 answer
  • De acuerdo a lo visto en clases, de los siguientes elementos señale 3 que no pueden estar ausentes en una célula.
    11·1 answer
  • HELP ASAP
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!