1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
2 years ago
9

What are the advantages to using prokaryotic as host systems for genetic engineering? What are the limitations to genetic engine

ering in prokaryotes? Are these limitations addressable in single cell eukaryotic systems? Give an example of bioproduction in each system.
Biology
1 answer:
ahrayia [7]2 years ago
5 0

Answer and Explanation:

The manipulation of the gene is called genetic engineering. In genetic engineering, fragments of genes are cloned by leading the genes into the host cell. The advantage of using a prokaryotic host system in genetic engineering is that bacterial cells are used to produce commercially significant products. For example, human growth hormone helps to treat dwarfism, and human insulin production, which is used to treat diabetes. The bacterium P.putida is created by genetic engineering, which is used to break down petroleum products. Genetic engineering also carries some potential risks, such as transferring the selected gene into another speice, benefit one species can harm another speice. Therefore genetic engineering must be used in limit in prokaryotes. These limitations are also addressable in single-cell eukaryotic systems. Biologics-based therapeutic medicines such as a vaccine, gene therapies, and cell therapies known as bioproduction are produced. Medicines are so complex that they can only be formed in a living system. Biopharmaceuticals, value-added food, fuels, chemicals, antibiotics, and many other products are produced by bioproduction.

You might be interested in
1. Fresh lava traps the direction of the earth's magnetic pole as it hardens.
melomori [17]
<span>1. As lava cools, it begins to go in the magnetic direction of the pole. It actually has been able to show magnetic pole changes throughout history this way. 2. The youngest rocks, crust, and fossils are near the ridge. 3. True, and this is essential for the theory of plate tectonics to work.</span>
6 0
3 years ago
Bell-shaped distributions produced by plotting results of f2 and f3 crosses are typical of which type of inheritance?.
harina [27]

Plotting the results of f2 and f3 crossings resulted in Bell-shaped distributions, which represent multiple-factor inheritance.

<h3>What transpires when an inheritance ends?</h3>

Lauren responds by fighting back, and as they struggle, Carson makes the claim that he is Lauren's biological father. However, Catherine seizes his gun and shoots Carson to death. All traces of Carson's captivity are eliminated when Lauren and Catherine work together to ignite the bunker by dousing it in gasoline and setting it on fire.

<h3>What is a bequest and why is it significant?</h3>

Evolutionary change requires the inheritance of genetic material. It explains the genetic transmission process from one generation to the next. The fact that genetic inheritance is rarely taken into account in life history research may therefore at first seem surprising.

To know more about inheritance visit:

brainly.com/question/14925026

#SPJ4

3 0
1 year ago
PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER.
masha68 [24]

Answer:A

Explanation:

6 0
3 years ago
Read 2 more answers
Write a three paragraph essay about AIDS. Include the following topics in your essay:
Colt1911 [192]

Answer:

Look up how to do this on Wikipedia.

Explanation:

3 0
3 years ago
Pls help fast I need to turn this in for Hw​
Gnoma [55]

Answer:

justified you happy if you happy birthday to u all a very often in mele me a copy for you to know about it is the gveyx the yellow gold medal for gallantry and hi in yaru eilva you are doing good and I love it rain

Explanation:

y ok good frd antha helli kelana in the wandering river in the yellow and red wine and I love the gveyx you are interested then please send the

5 0
3 years ago
Other questions:
  • This is the production and discharge of something, especially gas or radiation.
    9·2 answers
  • What sections of dna are used in dna fingerprinting apex?
    14·2 answers
  • 1. In Texas, the most common causes of collisions include speeding, driving under the influence of alcohol, and _____________.
    5·1 answer
  • True or false, the belief in Darwinism led persons to doubt that man owes anything to God?
    11·1 answer
  • After childbirth, a woman begins experiencing tremendous pain in her groin, making it difficult for her to walk. An X-ray shows
    10·1 answer
  • Which is accurate about the six kingdoms?
    7·2 answers
  • 2. The Isthmus of Panama cut off gene flow between Atlantic and Pacific populations of a species of fish. The cessation of gene
    15·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which formation of geographic
    6·1 answer
  • 15) naturally occurring variations within a species are mainly the result of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!