1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
14

1. Describe at least two things people can do today to help protect Earth and reduce levels of CO2.

Biology
1 answer:
kondaur [170]3 years ago
5 0

<span>1.       </span><span>Two ways that man can reduce the global warming is by reducing carbon dioxide (a greenhouse gas) emissions. One way is by planting more trees. Forests are reservoirs for carbon since their remove carbon dioxide from the atmosphere in the process of photosynthesis. Second is by reducing the use of fossil fuels to produce energy. Fossil fuels are the biggest emitter of carbon dioxide in their combustion</span>

<span>2.       </span>Greenhouse<span> gases permit infrared rays from the sun to pass through them but do not allow heat to escape into the atmosphere. When infrared hits the earth's surface it turns to the heat wave that has much longer wavelengths. This causes the earth’s atmosphere to retain more heat hence increased global temperatures.</span>

<span>3.       </span><span>When greenhouse gases especially carbon dioxide are reduced in the atmosphere, the earth is able to radiate more sunlight back into space due to the reduced greenhouse effect. This enables the global temperatures to remain low. At the poles where temperatures are cold remains even colder hence the waters in these regions turn to glaciers. The ice continents increase in size and hence a big characteristic of ice ages. </span>

<span>4.       </span><span>Humans are not responsible for global warming even though they contribute but in minimal proportions as compared to the natural process. This is because it is estimated that termites produce even more carbon dioxide than humans. Ice ages and global warming are therefore natural cycles governed by the sun. However, human activity aggravates global warming. </span>






You might be interested in
What four key inferences were discussed in lecture that derive from the phylogenetic analysis of the gene that encodes nucleopro
marishachu [46]
The four inferences were love, hate, war and the liberties of death.
5 0
3 years ago
The combination of a chemical reaction through which an organism builds up or breaks down materials as it carries out its life p
wlad13 [49]
Metabolism

Hope this helps!
5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
How does translation occur
julsineya [31]

Translation is the process by which a protein is synthesized from the information contained in a molecule of messenger RNA (mRNA). ... Translation occurs in a structure called the ribosome, which is a factory for the synthesis of proteins.  -google

7 0
3 years ago
Read 2 more answers
Plz help. i want to go play fortntie!! lol
seraphim [82]
It's the 3rd one
(^_^♪)
3 0
3 years ago
Read 2 more answers
Other questions:
  • An object's speed in a particular direction is called its.
    11·2 answers
  • The combining form ADIP/O means <br> A. skin. <br> B. membrane. <br> C. joint. <br> D. fat.
    5·2 answers
  • What are soft and hard callus? What are their functions?
    12·1 answer
  • HELP ME PLZ<br><br><br> What is the plot in the Greek Myth "Jason and the Golden Fleece" ???
    12·1 answer
  • Which phase results in chromosomes lining up towards the center of the cell, also known as the equator of the cell?
    9·2 answers
  • Help please with this
    8·2 answers
  • What is the answer with explaining
    5·1 answer
  • Study this unusual food chain. What could ‘P’ represent?
    9·1 answer
  • Autoclaving is the most effective among all moist heat-related antimicrobial methods. (True or False)
    9·1 answer
  • What's the difference between meiosis and mitosis​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!