All categories

3 years ago

What role do variations have in the theory of evolution by natural selection?

Biology

1 answer:

Black_prince [1.1K]3 years ago

3 0

Answer:

Individuals in a population are naturally variable, meaning that they are all different in some ways. This variation means that some individuals have traits better suited to the environment than others. ... Through this process of natural selection, favorable traits are transmitted through generations.

You might be interested in

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

A tragancio se le obstruyo el paso del jugo pancreatico al duodeno, se debioe. se alterara la digestion de las grasas sperar que

8_murik_8 [283]

Answer:

ecosistema terrestre es una comunidad de organismos y su ambiente que ocurre solo en masas de tierra, como continentes o islas. Ecosistemas terrestres. Tundra. Taiga. Bosque templado

8 0

2 years ago

Identify the structure of the human heart which is a large vein (right and left branches) that carries oxygenated blood from the

Dominik [7]

The pulmonary vein carries oxygenated blood from the lungs to the left atrium

6 0

3 years ago

Animal cell map to understand how cells function as the fundamental unit of life, you must first become familiar with the indivi

kodGreya [7K]

Answer:

a-synthesizes lipids

b-assembles ribosomes

c-defines cell shape

d-produces secretory proteins

e-modifies and sorts proteins

f-digests proteins

g-generates ATP

Explanation;

Some organelles and structures that make up the cell include; mitochondria, ribososmes, cell membrane, endoplasmic reticulum, golgi apparatus, lysosomes, among others,

-These organelles play individual roles in the cell; For instance;

Mitochondria-generates ATP

Lysosomes; digests proteins and worn out organelles

Golgi apparatus; modifies and sorts proteins

Ribosomes; Produces proteins

Endoplasmic reticulum; sythesis of lipids

Cytoskeleton; it gives the cell its shape

Nucleolus; manufactures and assembles ribosomes

etc.

7 0

3 years ago

Can you identify the process by which natural selection acts on an insect population exposed to pesticides?

NeTakaya

Identify the process by which natural selection acts on Change in Population the surviving insects reproduce. The frequency of resistant insects in the population increases.

Pesticides are any poisonous substances that are employed to kill animals, fungi, or plants and cause financial loss to crops or ornamental plants or pose a risk to domestic animals' or humans' health.
A pesticide is used on an insect population. Some insects possess a trait that renders them pesticide resistant. These flies remain. Without the gene, insects perish.

Insects that are still alive reproduce. Insects that are resistant are becoming more prevalent. Ecological Change Insecticide is used on a population of them.
Choosing Pressure Some insects have a trait that renders them pesticide resistant. These bugs are persistent. Without the gene, insects perish.

To learn more about Pesticides.

brainly.com/question/24316938

#SPJ4

7 0

1 year ago