1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
8

Required

Biology
1 answer:
evablogger [386]3 years ago
5 0
The answer is A. DNA
You might be interested in
Which of the following is NOT a function of a cell membrane?
lesya [120]

Answer:

A. the cell membrane protects the cell

8 0
3 years ago
What are details/evidence of a Prokaryotes? please help and thank you.​
kifflom [539]

Answer:

Prokaryotic cells are much smaller than eukaryotic cells, have no nucleus, and lack organelles. All prokaryotic cells are encased by a cell wall. Many also have a capsule or slime layer made of polysaccharide. Prokaryotes often have appendages (protrusions) on their surface.

7 0
2 years ago
Read 2 more answers
When a oligopoly exists, how many producers dominate the market
balandron [24]
In an oligopoly type of market, there are only few producers whom dominate the market. This is the market type wherein there are only small number of firms that control the majority of the market share. The opposite to Perfect Competition, wherein there are unlimited number of producers. In an oligopoly, since there are only a few numbers competitors, each firm is likely to be aware of each other's action.
7 0
3 years ago
How much atp is produced from one glucose molecule if no oxygen is available to a muscle cell during contraction?
andrew11 [14]
Production of ATP in the absence of oxygen is called anearobic respiration. Under anaerobic respiration,two molecules of ATP is produced from one molecule of glucose. These ATP are used for energy production by the contracting muscles.
6 0
3 years ago
10. Choose the correct option *
Zielflug [23.3K]

Answer:

Photosynthesis is the process in which light energy is converted to chemical energy in the form of sugars. In a process driven by light energy, glucose molecules (or other sugars) are constructed from water and carbon dioxide, and oxygen is released as a byproduct.

7 0
3 years ago
Other questions:
  • Identify and distinguish between the following characteristics of sound waves: frequency, pitch, amplitude, volume, and waveleng
    11·3 answers
  • This food web describes feeding relationships in a tropical community if an festive PC of large snakes enters this community whi
    12·1 answer
  • Which of the following BEST explains why using more than one assessment of cardiorespiratory fitness gives a better picture of f
    15·2 answers
  • Why do evergreen plants have needles rather than leaves?
    11·2 answers
  • What is one benefit of using tides for energy?
    9·2 answers
  • A variation of color field painting in which areas of flat color are separated by sharp, precise edges.
    12·1 answer
  • Please help! Pick on of the following
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • The bullfrog and the Northern cricket frog both reside in eastern pine forests and use many of the
    9·1 answer
  • A tropical grassland with sparse trees.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!