1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LUCKY_DIMON [66]
2 years ago
8

Match each of the five levels of organization to their proper definition.

Biology
1 answer:
zmey [24]2 years ago
8 0

1. Organ

2. Tissue

3. Organism

4. Cell

5. Organ System

You might be interested in
Viruses can infect bacteria as well as other organisms. What does the virus inject into the bacterial cell?
hoa [83]
A. Viral nucleic acid
7 0
3 years ago
Read 2 more answers
*10 POINTS PLS HELPPP
luda_lava [24]

Answer:

Explanation:

You got it right! It is in fact A.

8 0
3 years ago
What has been the evolutionary adaptation of elephants.
klio [65]

Answer:

Tusks I believe

Explanation:

8 0
2 years ago
Read 2 more answers
One advantage of sexual reproduction is that animals can
EleoNora [17]
^^ and if the parent has a defect or disease or whatever the offspring are less likely to have it
5 0
3 years ago
Which of the following is true about El Niño weather events?
rodikova [14]

Answer:

El Nino is a weather pattern which usually peaks during the winter months of the northern hemisphere. This weather pattern involves interaction between the ocean and the atmosphere, resulting in warmer waters in major areas of the Pacific Ocean. When that happens, global weather patterns will be affected so C.

Explanation:

5 0
2 years ago
Other questions:
  • Which of the following is an example of a decomposer?
    6·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Why does prolonged exposure to UV light from the sun or tanning beds increase the risk for getting skin cancer?
    11·2 answers
  • Radio waves can be damaging to the human body because they are waves with the most photon energy.
    14·1 answer
  • The management structures of both police agencies and correctional facilities are similar in that both have:
    6·1 answer
  • Why lack of vacuole in meristematic tissues
    10·1 answer
  • TRUE OR FALSE?
    8·2 answers
  • 8) This is the purpose for which something exists.
    9·1 answer
  • Please please help please please help me please I need help now please please help
    15·2 answers
  • Christy is studying sodium in the following periodic table of elements. She makes the following
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!