All categories

2 years ago

What is Elizabeth likely to observe about the investigation of cell transportation

Biology

1 answer:

Ymorist [56]2 years ago

8 0

The movement of substances across the cell membrane either into or out of the cell

You might be interested in

True or false? The liver is a component of the alimentary canal.

Oksanka [162]

<h2>False </h2>

Explanation:

Alimentary canal components include mouth, pharynx, esophagus, stomach, small intestine and large intestine whereas liver is a component of the accessory digestive system

The liver is a large organ that is located in the upper right portion of abdomen, beneath the diaphragm
The liver has two large sections, called the right and the left lobes and the gallbladder sits under the liver, along with parts of the pancreas and intestines
The liver and these organs work together to digest, absorb, and process food
The liver's main role is to filter the blood coming from the digestive tract, before passing it to the rest of the body
The liver also detoxifies chemicals and metabolizes drugs
The liver secretes bile that ends up back in the intestines and also makes proteins important for blood clotting and other functions

7 0

2 years ago

State at least <br>5 importance of soil to agricultural

andriy [413]

Answer:

Soil health is fundamental for a healthy food production. It provides essential nutrients, water, oxygen and support to the roots, all elements that favor the growth and development of plants for food production

Explanation:

3 0

2 years ago

Positive reinforcement is used to

raketka [301]

The first one, cause their trying to make it a positive way to reinforce. Which just means their trying to fix something again

8 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

What is the composition of earth’s ocean waters and where are they located

WINSTONCH [101]

Explanation:

Seawater is a complex mixture of 96.5 percent water, 2.5 percent salts, and smaller amounts of other substances, including dissolved inorganic and organic materials, particulates, and a few atmospheric gases.

hope this helps!!

8 0

3 years ago