1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
9

Please select the word from the list that best fits the definition Use an outline to answer your questions

Biology
2 answers:
yan [13]3 years ago
8 0

Answer:

write

Explanation:

I took test and got 100 and to Use an outline to answer your questions  you have to write

neonofarm [45]3 years ago
4 0

Answer: the answer is write

Explanation:

You might be interested in
Which ocean is below Asia and to the east of Africa.
klemol [59]

Answer:

Indian Ocean

Explanation:

8 0
3 years ago
Mangrove forests have traditionally been viewed as _____
Greeley [361]

The answer is D.) all of the above

6 0
4 years ago
Read 2 more answers
Explain Why Scientists Share Information with One Another
vodka [1.7K]
Scientists share information because by this they get to a deeper understanding of the experiments or their works
8 0
3 years ago
PLEASE HELP, I only have one attempt
Sedbober [7]
I THINK it’s (c) tell me if I am wrong
7 0
4 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Other questions:
  • A model that helps explain the results of Mendel’s crosses is called a ______.
    10·2 answers
  • Why was Dr. Salk's approach to developing a vaccine for polio considered unconventional and not fully accepted by fellow virolog
    11·2 answers
  • What is the purpose of the Surrogate Mother?
    12·1 answer
  • In pea plants, the allele for tall plants is dominant to the allele for short plants. if a homozygous tall plant is crossed with
    12·1 answer
  • Extra food is stored in a root's _____. <br> cuticle <br> cortex <br> pith <br> epidermis
    13·1 answer
  • The average young adult human male body contains about ________ liters of total body water.
    7·1 answer
  • Which air condition would be least likely to have precipitation?
    10·1 answer
  • Which pollutant is a constituent of soot?
    9·1 answer
  • Which correctly lists the two elements that make up the empty space in the universe?
    8·1 answer
  • How did scientists make glow-in-the-dark cats?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!