1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina [24]
3 years ago
13

Define Chromosome, gene, and chromatid. Draw a picture of a chromosome and label it. Write a brief summary of both videos (at le

ast 5 sentences each). From the second video make sure you include a chart that shows the differences between DNA and RNA.
Biology
1 answer:
g100num [7]3 years ago
5 0

Answer:

i can only define the terms for you.

Explanation:

chromosome - a threadlike structure of nucleic acids and protein found in the nucleus of most living cells, carrying genetic information in the form of genes.

chromatid - each of the two threadlike strands into which a chromosome divides longitudinally during cell division, each containing a double helix of DNA.

gene - a distinct sequence of nucleotides that forms a part of a chromosome, the order of which determines the order of monomers in a polypeptide or nucleic acid molecule which a cell or virus that may synthesize

You might be interested in
Cells Writing Prompt #1
Andreyy89

Answer:

popcorn kernels aren't living things

Explanation:

characteristics they have that show proof they are living organisms:

• movement when exposed to heat

• irritability/sensitivity since they react to change of temperature

• growth since when they are exposed to high temperatures they grow and become bigger

We can determine if they are living or not by:

• seeing if they respire

• seeing if they need nourishment

• seeing if they can excrete

• seeing if they can reproduce

In conclusion they aren't living things

8 0
3 years ago
A diploid number of chromosome is reduced to a haploid number
guajiro [1.7K]

Explanation:

In addition, in meiosis I, the chromosomal number is reduced from diploid (2n) to haploid (n) during this process. ... In humans (2n = 46), who have 23 pairs of chromosomes, the number of chromosomes is reduced by half at the end of meiosis I (n = 23).

7 0
3 years ago
What are the three major regions of the brain?
MakcuM [25]

The 3 main regions of the brain are the cerebrum, cerebellum, brainstem.

8 0
3 years ago
How do specialized cells relate to the different levels of organization in a multicellular organism?
Arisa [49]

Answer:Specialized cells perform specialized functions in multicellular organisms. Groups of specialized cells cooperate to form a tissue, such as a muscle.

Explanation:

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Jill lives in St. Louis, which is close to sea level. She decides to spend a month of her summer vacation working in the mountai
    12·1 answer
  • Natural influences in the Tundra Biome
    14·1 answer
  • Which arteries branch off the arcuate arteries?
    11·2 answers
  • Which function is specific to the neuron?
    15·2 answers
  • In 2010, a new type of life form was found in California's Lake Mono. The microbe found has a variation in the structure of its
    6·2 answers
  • 23. Economic systems_____
    15·1 answer
  • What is an easy definition for prokaryote and eukaryote? PLEASE ANSWER MY ASSIGNMENT IS DUE TODAY
    10·1 answer
  • If frogs are edible, why can't we eat cane toads?
    14·1 answer
  • A rock collection comes from which part of Earth?
    7·2 answers
  • Compare the general appearance of the DNA molecule with the mRNA molecule.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!