1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
3 years ago
10

Name 3 important organic molecules that are partially made from phosphorus.

Biology
1 answer:
agasfer [191]3 years ago
5 0

Answer:

As part of the phosphate group, it is a component of DNA, RNA, ATP (adenosine triphosphate), and the phospholipids that form all cell membranes.

You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Natural selection results in change over time by acting on traits that are ___
3241004551 [841]

Answer:

passed on, inherited, passed on to offspring, most adapted to the environment or have the best adaptive traits or higher genetic fitness

Explanation:

3 0
3 years ago
Read 2 more answers
How many hydrogen bonds hold together the c and g of complementary dna strands?
Svetllana [295]
Three hydrogen bonds.
6 0
4 years ago
ADH have which role on kidney? Help please ASAP!
NeX [460]

ADH is also called arginine vasopressin. It's a hormone made by the hypothalamus in the brain and stored in the posterior pituitary gland. It tells your kidneys how much water to conserve. ADH constantly regulates and balances the amount of water in your blood.


(My source was www.healthline.com in case you wanted to investigate for yourself. Hope this helps!)

6 0
4 years ago
Taste buds are found:
natta225 [31]
C. on the tongue,lining of the cheeks and on the roof of the mouth.
7 0
3 years ago
Other questions:
  • Biology.
    14·2 answers
  • Who is responsible of enforcing an environmental law after a legislature passes it?
    6·2 answers
  • Which biome would contain the most biodiversity in deciduous tree species? A. Taiga. B. Savanna. C. Temperate forest. D. Tropica
    7·2 answers
  • The distance between the first and third crest of an ocean wave is 24 meters. what is the wavelength of the ocean wave? A. 6 met
    14·1 answer
  • A lipid has three long chains of fatty acids and
    12·2 answers
  • When an earthworm moves what structures allow it to hold on to the soil
    8·1 answer
  • Which best describes the sex chromosomes in humans? A.Females have one X and one Y chromosome. B.Males have two Y chromosomes. C
    6·2 answers
  • TUESDAY, JANUARY 19, 2021 What are the 8 taxons (levels) in order? What are the 6 kingdoms Taxons Kingdoms
    5·1 answer
  • Describe two negative ways that the animals living in the area have been affected by the
    15·1 answer
  • Please help me please
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!