1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
3 years ago
8

What two gases easily diffuse through the phospholipid bilayer

Biology
1 answer:
natima [27]3 years ago
6 0

Answer:

Consider substances that can easily diffuse through the lipid bilayer of the cell membrane, such as the gases oxygen (O2) and CO2. O2 generally diffuses into cells because it is more concentrated outside of them, and CO2 typically diffuses out of cells because it is more concentrated inside of them.

You might be interested in
Which diagram in figure 32-2 shows an example of a joint involved in lifting your arms above your head?
Novosadov [1.4K]
The answer is Diagram A.
4 0
3 years ago
PLZZ HELPPPPP ASAPPP!!!<br><br> !!!!30 points !!!!
yaroslaw [1]

Using two heterozygous tall pea plants, so Tt is the genotype.

       T        t    <---- alleles from parent one

T      TT    Tt

t       Tt      tt

^alleles from parent two on the left

Results:  TT, Tt, Tt, and tt

Genotype ratio:  1/4 TT, 1/2 Tt, 1/4 tt

Phenotype ratio: T is dominant over t, so 3/4 tall and 1/4 short pea plants

8 0
3 years ago
Which of the following is NOT true about the FemCap cervical cap?
Kazeer [188]

Answer:

Explanation:

it must be kept in place at least 10 hours after intercourse

5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What is natural selection
AysviL [449]
Where organisms are better adapted to their environments tend to survive and produce more kids!
6 0
3 years ago
Read 2 more answers
Other questions:
  • Cells help organisms carry out many processes,such as?
    15·2 answers
  • PLEASE ANSWER 10 POINTS!!!!!!! Describe an approach for understanding global systems and the changes they undergo.
    6·1 answer
  • There are six people in the Fisher family. Olivia and Marcus are the parents. They have four children: Violet, Nathan, Jonas, an
    10·2 answers
  • Jennifer’s children have always been short when compared to their classmates. One day her son blurted out, "I can’t wait until I
    5·1 answer
  • Photosynthetic (autotrophic) protistans include all of the following except?
    7·1 answer
  • Which is the best example of an abiotic factor in a ecosystem? A. Planting new trees B. Hunting C. Building a dam D. Harvesting
    14·1 answer
  • Define cellular respiration, and state where it takes place.
    13·1 answer
  • What effect do enzymes have on chemical reactions?
    6·1 answer
  • angie's mom can roll her tongue will angie be more likely to have that ability or more likely not to have that ability ​
    7·1 answer
  • What is the function of the tendons?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!