Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The correct option is : c. gas gangrene
Explanation:
Gas gangrene is a serious bacterial infection caused by the infection of the Clostridium perfringens bacteria. This bacteria is always present in the nature and is a rod-shaped, gram-positive bacteria, that belongs to the Clostridium genus.
This disease can cause gas production in gangrene, death of the muscle tissues and also sepsis.
<u>Therefore, Gas gangrene is most associated with the bacteria Clostridium perfringens.</u>
Answer:
The moment where the nuclear envelope forms at each pole spindle dissolves chromosomes uncoil is called Telophase.
Explanation:
In the eukaryotic cell, telophase is the final stage in meiosis and mitosis. In this step, the effects of prophase and prometaphase are reversed. This is the forth stage and a nuclear envelope forms at each pole. The spindle dissolves and the chromosomes uncoil, cytokinesis begins. The cell continues to enlogate.
