1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ICE Princess25 [194]
3 years ago
9

A goal that is attainable for one person may be unattainable for another. True False

Law
1 answer:
marissa [1.9K]3 years ago
7 0

Answer:

Explanation:

Utterly true.

I once asked my wife to teach me to draw an Erlenmeyer flask. She showed me, and she's a good teacher. Then she said "Draw 50 of these. By the time you've done that, you should see how the lines work." She was wrong. My first flask was no worse nor better than the 50th one and I never did see how the lines worked.

I can do math, but my drawings look like I never graduated from Grade 1.

You might be interested in
List and describe the Bias of each of the 12 jurors in order. 12 angry men movie
mixas84 [53]

Answer:

olah what iti qistion

Explanation:

cnot undstiande

3 0
3 years ago
A defendant is on trial for a murder that occurred during a robbery at the victim's home. a witness helped the police artist com
olya-2409 [2.1K]

Answer:

No, as hearsay not within any exception.

Explanation:

(B) The sketch is inadmissible on hearsay grounds. Under Rule 801 of the Federal Rules, prior identification can be admissible, and the sketch could be deemed a prior identification. However, to be admissible, the witness must be there to testify at trial and be subject to cross-examination. The witness in this case is unavailable; hence, this exception does not apply. (D) is therefore incorrect. (A) applies to documentary evidence and has no relevance to this question. (C) is likewise not applicable, because this exception applies only to information within the personal knowledge of the public employee. In this case, the public employee gained the knowledge from the hearsay statements of an absent witness.

8 0
2 years ago
Anyone have an Pokemon Go account I can have. Please and Thank You
Vadim26 [7]

Answer:

No i dont

Explanation:

6 0
3 years ago
Sawarasenai kimi wa shojo nano??
insens350 [35]
Say what now I don’t understand this.
4 0
3 years ago
Read 2 more answers
Why is the due process clause of the U.S. Constitution relevant to parental rights?
monitta

Answer:

The Due Process Clause of the constitution is relevant to parental rights because  under the 14th amendment and the due process clause it protects a parents right to bring up their child how they wish.

Explanation:

4 0
3 years ago
Other questions:
  • What is the main objective of the placement stage in the money laundering process?
    12·2 answers
  • What was the ruling of the case Benett v Jeffreys?
    10·2 answers
  • Which of the following is NOT a new technology that makes correctional<br> institutions safer?
    7·1 answer
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • The following people have been arrested and charged with a variety of crimes. For each case, decide whether the person should be
    15·2 answers
  • Why did my dad hasn't come back with the milk?
    10·2 answers
  • Are the most common location for a collision between a bike and a car
    9·2 answers
  • Fatima signs up to volunteer with the Special Olympics. Which task might she complete as part of her duties?
    10·1 answer
  • Is second appeal possible in order?.
    11·1 answer
  • Does spending the most money usually result in an election victory?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!