1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
5

Explain how the results exclude the possibility that the trait is encoded by a mitochondrial gene.

Biology
1 answer:
lisov135 [29]3 years ago
7 0

Answer:

Mitochondrial gene is the gene which inherited from mother  tothe offspring.

Explanation:

Some portion of DNA is also present in the mitochondria of the cell so mitochondrial gene is also transmitted from parent to their offspring. In humans, mitochondrial gene is transmitted from only one parent i. e. mother not father. The mitochondrial disease occurs in the human if the disease is present in the mother because it is transferred through genes from mother to their offspring. There are variety of diseases that occurs due to mitochondrial gene such as Mitochondrial myopathy, Diabetes mellitus and deafness etc. So the mitochondrial gene plays a vital role in the structure and function of human body.

You might be interested in
For average organism, heavy digestion (overnight with an excess of enzyme) of chromatin with micrococcal nuclease would yield a
ASHA 777 [7]

Answer:

150 - 300 bp

Explanation:

Micrococcal nuclease, indistinctly from the time of treatment and in average organisms, will realize the cuts on DNA o RNA zones rich in AT or AU. It is not a specific endonuclease.

Even so, the mean size of the expected fragments will have between 150 bp and 300 bp.

It is very important to run your digestion along with a proper label.

5 0
3 years ago
PLEASE HELP!!!!!!! PEASEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
FinnZ [79.3K]

Answer:

it's not clear

and not seeing the system clearly

5 0
3 years ago
Which of the following mutations would most likely affect the offspring of an<br> adult cat?
Ymorist [56]

Answer:

reproductive system

Explanation:

7 0
3 years ago
Read 2 more answers
___________________ are mutualistic fungi that help provide nutrients to trees, shrubs, and other plants.
Drupady [299]
The answer is Mycorrhizae. ;)
5 0
3 years ago
Why the rainforest in Costa Rica is not rich with plants? Remember to use scientific language
Troyanec [42]

Answer:

Deforestation is the major problem causing lack of rich species in Costa Rica. This is due to over grazing by cattle.This may lead to flooding which affect fertility of the soil.These animals graze on  the plants without regulations,and cause erosion as their hoofs percolate the soil,  further reducing soil fertility.

In addition to sustain the beef production,  trees were fell to for cattle ranching.This ultimately contributed to loss of the forest species.

Banana plantation is an  additional factor.Forest were cleared to cultivate banana, which affects forest population.

Explanation:

3 0
4 years ago
Other questions:
  • Help Me Out With This Question Plz Thanks!!!​
    13·1 answer
  • The driving force behind gas exchange in the body is
    13·1 answer
  • How do aquatic factors affect the distribution of aquatic life (include both biotic and abiotic factors)?”
    14·1 answer
  • "which of these illustrates the secondary structure of a protein?"
    10·1 answer
  • 20. Unlike monocots, dicots have
    11·1 answer
  • Many biotic factors affect individuals in a population. An example of an organism being directly affected by a biotic factor is
    14·1 answer
  • What two tissues are found within a vein
    15·2 answers
  • Which are units used to express volume?
    9·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The cytolysis of red blood cells is specifically called
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!