When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP). ... Likewise, energy is also released when a phosphate is removed from ADP to form adenosine monophosphate (AMP).
Answer:
Children born to mothers with dark skin, living far from the equator.
Explanation:
I would say this is the answer but I'm not sure. This is just what I think. I asked my mom about it and she said the same thing I did. I hope this helps.
Answer:
D
Explanation:
DNA use thymine and rna uses uracil but they use a,c,g together
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Explanation:
The autonomic nervous system _____.
A. controls involuntary actions
The nervous system is subdivided into; the central nervous system (CNS), which includes the brain and spinal cord, within the vertebral column; and the peripheral nervous system, which includes nerves that branch into the rest of the body from the brain and spinal cord. Nervous tissue responds to electrical impulses, allowing for communication between different regions of the body.
The peripheral nervous system is further divided into the somatic nervous system responsible for carrying out sensory and motor information between the peripheral nervous system- including sensory organs like the eyes; and central nervous system; and the autonomic nervous system (ANS) which regulates involuntary bodily functions like heartbeat, breathing and blood flow. The ANS is mainly acts unconsciously and affects smooth muscle and internal organs. It is related to homeostasis- where the body maintains a constant internal balance in pH, temperature, blood pressure etc.
Learn more about the autonomic nervous system at brainly.com/question/10386413
Learn more about homeostasis at brainly.com/question/1601808
#LearnWithBrainly
