1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina CMI [18]
3 years ago
12

Would it be ideal if temperatures are often below freezing where you launch rockets?

Biology
2 answers:
zysi [14]3 years ago
7 0

Explanation:

And it should go without saying that you don't want to launch during a hurricane or tornado. If the rocket flies into a thunderstorm then it will attract lightning strikes. This was partly attributed to the low temperature weather, far lower than had been the case with previous launches: below freezing at 28.

AleksandrR [38]3 years ago
6 0

Answer:

I do not think it matters but if I had to choose I would say it does not matter

Explanation:

the rocket has a huge flame that propels it through the air

You might be interested in
What is the formula to solve for mass in specific heat capacity?
Setler79 [48]
Quantity of Heat = Mass x Heat Capacity x Temperature Change 
This may be shortened to: 
q = mcΔT 
where: 
q = Quantity of heat in Joules (J) m = Mass of the substance in grams (g) c = Specific Heat Capacity (Jg-1) ΔT = Change in Temperature (Δ = This symbol is "delta", which is Greek for "change") 
8 0
3 years ago
What macromolecule is made up of nucleus acids?
Salsk061 [2.6K]

Answer:

The correct answer to the question above is letter c. DNA is a macromolecule.

6 0
3 years ago
What is the process of cell division in prokaryotes?
Nina [5.8K]
Cell division<span> is part of the life cycle of virtually all</span>cells<span>. </span>Cell division<span> is the </span>process<span> in which one </span>cell<span>divides to form two new </span>cells<span>. Most </span>prokaryotic cells<span>divide by the </span>process<span> of binary fission. In eukaryotes,</span>cell division<span> occurs in two major steps: mitosis and cytokinesis.</span>
3 0
3 years ago
Explain what diversity means in biology
Andrei [34K]
Different types of species
5 0
3 years ago
What determinant of mean arterial pressure would be directly affected by lasix, and would this typically raise or lower mr. unde
Marysya12 [62]
<span>By definition, the two determinants of mean arterial pressure are cardiac output and total peripheral resistance. It has been shown that Lasix decreases cardiac output and total peripheral resistance. Diuretics increase urine production, so it will lower mean arterial pressure.</span>
5 0
3 years ago
Other questions:
  • Boojho had the following parts of a rose plant- a leaf, root, a flower of, a bud and pollen grains. Which of them can be used to
    6·1 answer
  • Erwin Chargaff observed that the proportions of adenine (A) and thymine (T) bases were always equal, as were the proportion of g
    11·1 answer
  • In a cell, A. energy-releasing reactions are coupled to energy-absorbing reactions. B. more energy is used up than is produced.
    8·1 answer
  • What cross will produce the most pink-flowered plant?
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why is this experiment invalid?
    5·1 answer
  • During careful listening, your heart rate will quicken and your body temperature will rise. True or false?
    10·1 answer
  • Can someone please answer the question I have my finger on
    9·1 answer
  • How did dolly the sheep die
    7·1 answer
  • What type of boundary is depicted in the image below?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!