The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Answer:
1) jaws
2) amniotic eggs
3) turtle
4) lancelot, because they are farthest apart and share the least amount of traits
Explanation:
as you make your way through the cladogram you'll see that with more traits being added the less alike they are. for example turtle is closest to leopard because they share all the previous traits excluding hair which something only the leopard has.
A true-breeding plant is one that, when self-fertilized, only produces offspring with the same traits. True-breeding organisms are genetically identical and have identical alleles for specified traits. It is a kind of breeding wherein the parents would produce offspring that would carry the same phenotype. Basically true means identical or same. Hope this somewhat helped :)
There are two important regions of a lipid that provide the structure of the lipid bilayer. Each lipid molecule contains a hydrophilic region, also called a polar head region, and a hydrophobic, or nonpolar tail region
