1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
2 years ago
9

The digestive, respiratory and circulatory systems are controlled

Biology
1 answer:
Maksim231197 [3]2 years ago
4 0

Answer:

D

Explanation:

You might be interested in
What does a plant need to create a glucose molecule in photosynthesis?
DerKrebs [107]

Answer: 1 glucose

Explanation: Basically, in photosynthesis, energy from light is used to convert carbon dioxide and water into glucose and oxygen. For 6 carbon dioxide and 6 water molecules, 1 glucose molecule and 6 oxygen molecules are produced. So your answer is 1 glucose. BTW, I got my answer from Google and from the website called thoughtco    Go check it out!

4 0
3 years ago
MEDALSS!!
lawyer [7]
During the S phase in the cell cycle, the chromosomes are replicated so that there are two copies. These copies are necessary so that each daughter cell created during the M phase will have an identical copy of the DNA.

Therefore, the answer is A: The DNA must be replicated. 


The chromosomes joining, cell membrane expanding, and cytoplasm separating all happen during the M phase (mitosis).
4 0
3 years ago
Describe 3 main differences between rna and dna
Sati [7]

Answer:

The three main differences between RNA and DNA is that (1) The sugar in RNA is ribose instead of deoxyribose, (2) RNA is generally single-stranded and not double-stranded , and (3) RNA contain uracil in place of thymine. ... The three min types of RNA are Messenger RNA, Ribosomal RNA, and Transfer RNA.

Explanation:

hope it helps : )

5 0
3 years ago
What is an important task of
Otrada [13]

Answer:

B

Explanation:

Proofreading" the new DNA strands in

DNA replication

5 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • Give 3 real world examples of “science” and “not science”
    7·1 answer
  • Salt is made up of a atom of sodium and a atom of chlorine. True or False
    15·1 answer
  • The process of making rna from dna is called transcription and it occurs in the
    10·1 answer
  • 5
    12·1 answer
  • Compared to plants from other environments, the cells of many desert plants contain high concentrations of solutes. This helps t
    9·2 answers
  • The two processes that move the most amount of carbon through the carbon cycle are? a.photosynthesis and respiration b. decompos
    8·1 answer
  • 2. Lisa breeds snakes. She bred a solid brown male python with a tan female python whose body was covered with a black diamond p
    15·2 answers
  • How does binomial nomenclature help scientists?<br><br>help!!!​
    8·1 answer
  • What kingdoms are Protist's NOT part of?​
    12·1 answer
  • 2. Imagine a population of crabs living on a white sandy beach. The crabs ONLY occur in two colors- red and blue, each controlle
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!