1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
3 years ago
8

Air, water, light, temperature and pH makes up the

Biology
2 answers:
Phoenix [80]3 years ago
4 0
Heyy :))

The best answer would be:
<span>Abiotic environment

Hope this helps!
Good day :D</span>
asambeis [7]3 years ago
4 0
Ans is <span>abiotic environment</span>
You might be interested in
Use the scenario to answer the question.
Murljashka [212]

Answer:

fruit weight

Explanation:

In an experiment, the dependent variable is the variable that responds to the changes made to the independent variable. In other words, the dependent variable, as the name implies, is DEPENDENT on another variable called independent variable. The dependent variable is the variable that is measured or recorded by the experimenter during the experiment.

In this case where a student is studying the effect of fertilizer on fruit growth. He uses 6 tomato plants, which were given different concentrations of fertilizer (independent variable). After the experiment, the weight of the tomato fruit were measured. This means that the FRUIT WEIGHT is the dependent or responding variable.

5 0
3 years ago
What is the approximate longitude of the most easterly boundary of the united states
stepladder [879]
<span>Cape Prince of Wales, at 168°05′05″W, is the westernmost point on the mainland of the Americas. </span>
5 0
4 years ago
Suppose the climate in an area becomes much drier than it was before. How would the plants be effected in terms of natural selec
Sedaia [141]
They were adapted to an environment and once it is taken away the plants will slowly start to die. I'm not 100% :)
3 0
4 years ago
Read 2 more answers
7.
mestny [16]

Answer:

6 hours

Explanation:

after death every hour drops to 1.5 the temperature so if you multiply 6 * 1.5 it equals 9 and if you subtract that the 97.6 which is the average heat temperature of the adult then you will get 88.6 degrees which would be around your question

6 0
3 years ago
(Select all that apply)
Harlamova29_29 [7]
3 position of the molecules.
8 0
4 years ago
Other questions:
  • Which of the following bodies of water is bounded in three sides by Australia and to the north by the Arafura sea?
    9·1 answer
  • Why are multiple forms of documentation used at the scene of a mysterious death (note taking, sketching, photography, or videogr
    5·1 answer
  • I will mark you bainly. please help! :D
    14·1 answer
  • The ecosystem of a lake includes
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What does the term EUKARYOTIC mean? ?
    12·1 answer
  • Pleasssss help <br>This is also due today
    13·1 answer
  • Select 3 terms that apply to level 1 of the pyramid
    8·1 answer
  • Science activity 1.4.2​
    8·2 answers
  • One afternoon, there was heavy rainfall, and many large puddles formed on Rachel's street. A few days later, Rachel noticed the
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!