I believe they are made of the same thing our ribs are made of Bones
Answer:
False
Explanation:
Candling is used to study the embryo. An intense source of light is placed behind the egg to visualize the internal developments and changes. Here, candle is used as a source of light.
Bacteria and viruses cannot be observed in the light of a candle. However a virus is much smaller as compared to a bacteria and it can be seen only in electron microscope.
Thus, the given statement is false
The opposite end of the chlorophyll molecule is made up of CARBON.
The chlorophyll refers to the chemical substance in green plants which helps the plants to trap energy from the sun for their food production. Structurally, the chlorophyll is made up of a central magnesium metal ion which is bonded to a large organic molecule called porphyrin.
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Copepods primary producer, phytoplankton secondary consumer, herring tertiary consumer, sea lion quaternary consumer, and the killer whale is the primary consumer.