1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
7

Leaving this here . dont have to answer all just share what you know. no links.

Biology
1 answer:
IgorLugansk [536]3 years ago
4 0

Answer:

How is your day going?

Explanation:

You might be interested in
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
A ________ force is when two forces cancel each other out and do not affect the motion of an object.
lisabon 2012 [21]

Answer:

This is your answer ☺️☺️☺️

7 0
3 years ago
Read 2 more answers
Please help with hthis question
kupik [55]
I think it’s earthworm
6 0
3 years ago
How are erosion and weathering alike
yaroslaw [1]
Weathering and erosion are similar in that they both work together to change and shape the Earth's surface. While weathering breaks rock and earth down, erosion is the displacement of the pieces and particles of rock and earth.
3 0
3 years ago
Read 2 more answers
Which factors are involved in earthquake formation? Check all that apply. plates moving rocks breaking stress that decreases fau
AfilCa [17]

The correct answers are:

- plates moving;

- breaking rocks;

- movement bellow the surface;

The earthquakes are a direct result of the plate tectonics. In order for an earthquake to appear, there should be a geologic activity caused by the movement of the tectonic plates. The movement of the tectonic plates causes a lot of pressure on the rocks. The rocks eventually break at certain places under the pressure. A they break, there's movement bellow the surface, or rather inside the crust, also referred to as adjustment. That movement and the release of power from it, causes lot of strong vibrations. The vibrations spread out and start shaking the ground in the surrounding area, which is actually the earthquake itself.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The three agents of metamorphism are _____. melting, pressure, and weathering heat, pressure, and hydrothermal solutions heat, e
    5·2 answers
  • What would happen to the bear population if the forest they lived in was cut down and a mall was built?
    9·1 answer
  • The _____ surrounds the nucleus of the cell and helps assemble and package materials made in the cell
    8·1 answer
  • I'll mark Brainiest Answer Fast
    7·2 answers
  • When Mendel crossed true-breeding tall pea plants with true-breeding short pea plants, all the offspring were tall. Then he allo
    13·1 answer
  • Why is water considered a thermostat for earth?​
    6·1 answer
  • Identify the energy carrier molecule ATP and its importance​
    10·1 answer
  • What is the defining characteristic of an acid?
    9·1 answer
  • True or False. Scientific names use the Spanish language.
    15·2 answers
  • 4. How can one patient have a radiologic procedure to diagnose a condition, while another has radiation treatment to destroy a t
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!