1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesnalui [34]
4 years ago
14

In an angular unconformity, the eroded rock is tilted or folded. True False

Biology
2 answers:
Vika [28.1K]4 years ago
5 0
I think that that is true
AlladinOne [14]4 years ago
3 0
True they are tilted or folded
You might be interested in
what is the substance found in many plants that is not considered a nutrient but has many healthful benefits?
amid [387]

Answer:

The correct answer is phytochemicals.

Explanation:

Phytochemicals refer to the components, which are generated by plants. They are witnessed in vegetables, fruits, beans, grains, and other plants. Some of these phytochemicals are considered to protect cells from destruction, which could result in cancer. The phytochemicals are not considered as nutrients, but possesses many health benefits:  

1. It helps in ceasing carcinogens from attacking cells.  

2. It helps to prevent the generation of potential cancer-resulting substances.  

3. It assists the cells to prevent and eradicate any kind of cancer-like modifications.  

Some of the phytochemicals, which are considered as the most beneficial ones are polyphenols in tea, beta-carotene and other carotenoids in vegetables and fruits, and isothiocyanates found in cruciferous vegetables.  

8 0
3 years ago
Which term describes the site of a muscle attaching to the bone that moves the most?
lions [1.4K]

Answer:

Insertion

Explanation:

3 0
3 years ago
If a pea plant has the two alleles YY. What is its phenotype?
vichka [17]
It would be a dominant yellow plant lol
8 0
3 years ago
What are liters milliliter and cubic centimeters used to measure
Vinvika [58]
They are all used to measure volume
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • How does science shape our world?
    5·2 answers
  • Genomic imprinting, dna methylation, and histone acetylation are all examples of
    7·1 answer
  • g Antibodies are proteins that recognize a particular antigen and are produced by specialized B cells. Antibodies consist of pol
    8·1 answer
  • Suppose that the X‑linked recessive condition hemophilia A affects 1 in 5000 males in the United States. Assume that the only tw
    12·1 answer
  • A moss-covered log is overturned by a hungry bear looking for insects to eat. The bear disturbs an ant colony, and some chipmunk
    5·1 answer
  • In general, life needs to maintain a pH level between<br>O 1-4<br>05-8<br>9-14​
    15·2 answers
  • Whet era does the rock of the Canadian Shield date back to
    14·1 answer
  • A polypeptide only becomes a functioning protein after it has folded into its exact 3D shape.
    5·1 answer
  • According to the principle of causal determinism, everything that will happen in the future is the consequence of what has happe
    10·2 answers
  • A substance taken into the body by ingestion, inhalation, injection, or absorption that interferes with normal physiological fun
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!