1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
3 years ago
15

When the concentration of molecules on both sides of a membrane is the SAME, the solution is

Biology
1 answer:
Brilliant_brown [7]3 years ago
8 0

Answer:

When the concentration of molecules of a substance is the same on both sides of a membrane the solution is isotonic.

Explanation:

A given substance, when it has the same concentration on both sides of the membrane, is in equilibrium and the solution is called isotonic, from the extracellular space with respect to the cytoplasm.

The cell membrane is semipermeable to the passage of water and some substances. Hypertonic and hypotonic solutions tend to establish the dynamics of entry and exit of molecules or water, due to the concentration or osmotic gradients that are established, respectively.

An<u> </u><u>isotonic solution </u><u>does not generate gradients</u>, because the concentration of molecules is equal in the extracellular space with respect to the intracellular space.

You might be interested in
Dog breeding is an example of _____________________________________. Where man chooses the beneficial traits and controls the br
Tems11 [23]

Dog breeding is an example of Associative mating.

7 0
3 years ago
If a brown hair allele is represented with a B, and blonde hair is represented with a b
joja [24]

Answer:

B. Brown Hair is dominant.

Explanation:

The dominant allele is represented with a capital letter, and a recessive allele is represented with a lower case letter.

Therefore, In this example brown hair is dominant. :)

3 0
3 years ago
Read 2 more answers
When did lamarck publish his ideas on evolution answers?
Leto [7]
The answer should be <span>early 1800's </span>
8 0
4 years ago
Read 2 more answers
A series of muscular contractions that divides and mixes chyme within the small intestine is called __________.
xz_007 [3.2K]
<span>the answer is c. segmentation </span><span />
6 0
3 years ago
Read 2 more answers
You have been put in charge of designing an ad campaign for your area to get more people to use public transportation. One part
ValentinkaMS [17]

Answer:I'm doing this right now and have no clue sorry ;-;

Explanation:

3 0
3 years ago
Other questions:
  • 173
    8·1 answer
  • When light strikes the second medium what are the two things that happen?
    11·2 answers
  • Which scientist hypothesized that more offspring were born in a population than could survive based on limited resources?
    14·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Imagine that there is a direct correlation between feeding efficiency and reproduction (the more resources you can gather, the m
    15·1 answer
  • Which role of bacteria is the most beneficial in terms of maintaining the health of the plant populations in our ecosystems?
    11·1 answer
  • Ocean dumping is a source of pollution for which type of environment?
    9·1 answer
  • A sample of water containing somehow and bacteria was kept in a container. After some days it was observed that only snowball ex
    13·1 answer
  • Help please! Thanks so much!
    12·2 answers
  • What are the differences between the transport of materials in xylem and phloem ? I need long answer, pls help me guys.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!