1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marta [7]
3 years ago
12

Jennifer observes a weather map showing tomorrow's weather. She predicts that air will travel from the low pressure system to th

e high pressure system, causing wind. The wind will carry moisture since it is coming from the ocean. Choose the statement which corrects the error(s) in Jennifer's prediction. (2 points)The wind from the ocean will not carry moisture.
The wind will travel from the high pressure system to the low pressure system.


Since the low pressure system is not over land, wind will not be created.


Wind is only created when two high pressure systems meet.
Biology
2 answers:
bezimeni [28]3 years ago
8 0

Answer:

c

Explanation:

Aleksandr-060686 [28]3 years ago
5 0

Answer:

Jennifer observes a weather map showing tomorrow's weather. She predicts that air will travel from the high pressure system to the low pressure system, causing wind. The wind will carry moisture since it is coming from the ocean.

Explanation:

Winds refers to the movement of air which are produced due to differences in air pressure.

These pressure differences are to uneven heating of the earth by the sun. Due to the uneven shape of the earth, regions around the equator receive a fairly consistent heating from the Sun. However, with increase in latitude north and south, there is more uneven heating of the earth's surface by the Sun. When air is heated, warm air rises up to the atmosphere. This produces a pressure difference and subsequently cold air sinks downward to replace it. This constant air movement results in winds. The winds generated moves from a high pressure system to a low pressure system. The greater the pressure difference, the greater the wind force.

When warm air from land rises, air from the ocean in to replace it. The wind coming from the ocean is moisture-laden, and results in precipation on land.

You might be interested in
What is one purpose for the peer-review process in scientific research?
Vesnalui [34]

Answer:

Its used as validity, and quality of the articles. The main purpose of it is to filter out poor or invalid articles.

Explanation:

9 0
3 years ago
Which system sends messages about the senses to the brain
vagabundo [1.1K]

Answer:

The Nervous System

The basic workings of the nervous system depend a lot on tiny cells called neurons. The brain has billions of them, and they have many specialized jobs. For example, sensory neurons send information from the eyes, ears, nose, tongue, and skin to the brain.

Explanation:

Hope It Help

3 0
3 years ago
What phase of mitosis is this?
aleksley [76]

Answer:

Interphase

Prophase

Metaphase

Telophase

Anaphase

4 0
2 years ago
What determines whether a resource is considered renewable? *
solmaris [256]
C bc the key word is replaced
7 0
4 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Can I use capture-recapture method to estimate the population of grasshoppers in my backyard?
    11·1 answer
  • What term refers to polluted sites that can be cleaned and revamped?
    6·2 answers
  • Which statement describes what happens to the carbon dioxide produced in cellular respiration? It is excreted from the body as l
    10·1 answer
  • Question 4
    8·2 answers
  • How does a cell interpret the genetic code
    6·2 answers
  • Pleasseee answer this
    6·1 answer
  • The part of an animal cell that serves as barrier between the cell and its environment is the A. nucleus. B. cytoplasm. C. mitoc
    12·2 answers
  • If a bacterial cell undergoing binary fission failed to replicate its DNA before the division process occurred, what might resul
    10·2 answers
  • If a course includes an online textbook/e-book under which link can it be found?
    15·2 answers
  • Lactase deficiency is more common in Asian, Native American, Mediterranean and some African populations than it is among people
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!