1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
15

WILL MARK BRAINLIEST

Biology
2 answers:
eimsori [14]3 years ago
5 0
The correct answer is B. 50 percent
Drupady [299]3 years ago
4 0

Answer:

50percent is the answer

You might be interested in
What causes a gene to be passed on to
Neko [114]

Answer:

A.

Explanation:

DNA is replicated through reproduction to the offspring. Hope this helps :)

8 0
2 years ago
At the conclusion of a unit about reliable source material and contemporary journalism, a teacher asks her students to write two
denis23 [38]

Answer:

Analyze

Explanation:

Bloom's Taxonomy is a method of classifying learning from complex to specific. Mostly represented as a pyramid from bottom to top is remember, understand, apply, analyze, evaluate and create.

For this example of a "fake news" story the tier of "Analyze" is applicable since it will require the use of judgement, and comparing and contrasting as well as discernment skills.

7 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Melvin calvin and his colleagues noted that when 14co2 was added to algal cells, a single compound was radiolabeled within 5 sec
vovikov84 [41]
<span> 3-phosphoglycerate is a compound that produced.</span>
4 0
3 years ago
In 1859, two dozen rabbits were introduced to Australia. By 1953, there were an estimated one billion rabbits in Australia. The
mart [117]

Answer:

Explanation:

b

6 0
3 years ago
Read 2 more answers
Other questions:
  • Where does the energy come from to drive the water cycle?
    6·2 answers
  • Biology helpp please,, tysm !! <br> reward is 10 points
    8·2 answers
  • As they multiply, die and decompose, algae deplete the ocean’s surface layers of oxygen. Often, the large amounts of farm fertil
    6·2 answers
  • In any one animal the chromosome number is exactly the same in?
    8·2 answers
  • In a mixture of sand and rock in gravel, different components are easily observed. Which term best describes this mixture?
    11·1 answer
  • How does the relationship between flying dragons and trees compare to that of iguanas and trees?
    7·2 answers
  • How was the first human created?
    5·2 answers
  • 3. The main source of organic matter in soil is<br> A bacteria<br> B fung<br> c plants<br> water
    7·1 answer
  • NADP+ and NAD+ are similar in that both...
    15·1 answer
  • 6. Adolescent females often require additional amounts of iron in their diet. Explain why.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!