That would be yes cause thy are all the same cells unless in in different envirment
Parasympathetic nerves govern involuntary actions such as pupil dilation, peristalsis, gland secretions, etc.
Answer:
b. pass through pores in the capillary endothelium
Explanation:
The fenestrated capillaries and sinusoids have pores in their endothelium. These pores or the intracellular clefts vary in size between the fenestrated capillaries and sinusoids. Sinusoids have larger intracellular clefts. The pores serve as a passage for the movement of water-soluble substances, proteins and other substances that cannot cross the hydrophobic interior of the cell membranes.
Water-soluble hormones also cannot pass through the capillary walls. Therefore, these hormones pass through the pore or the fenestrations present in the endothelium of capillaries.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
