1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
joja [24]
3 years ago
5

What makes a membrane semipermeable?

Biology
1 answer:
nikklg [1K]3 years ago
8 0

Explanation:

Membranes

Recall that phospholipids have a hydrophobic end and a hydrophilic end and that when placed in water they will orient themselves accordingly (5.11 pg 79). This is the basis for the plasma membrane of a cell. The cell membrane consists of a phospholipid bilayer with embedded proteins. We refer to the modern conceptual model of the cell membrane as the "fluid mosaic" model since the phospholipids are able to move about across the surface of the membrane (fluid) and the proteins are many and varied (mosaic) (5.12).

Attached to the some proteins and to some of the phospholipids are oligosaccharides (short polysaccharides). When a protein has an oligosaccharide attached it is called a glycoprotein. Glycolipids are phospholipids with the sugar chains added. These oligosaccharides are found on the outside of the membrane and are used in cell to cell recognition. They differ among species, among individuals and within individuals.

Membrane proteins can have a number of functions, such as transport proteins, enzymes (more on these shortly), receptor sites, cell adhesion, attachment to the cytoskeleton. (5.13)

The most important thing about membranes is that they regulate what moves in and out of a cell. The membrane is selectively permeable because substances do not cross it indiscriminately.

Some molecules, such as hydrocarbons and oxygen can cross the membrane. Many large molecules (such as glucose and other sugars) cannot. Water can pass through between the lipids. Ions such as H+ or Na+ cannot.

Transport proteins make passage possible for molecules and ions that would not be able to pass through a plain phospholipid bilayer. Some transport proteins have a hydrophilic tunnel through them which allows polar molecule or ions to pass. Others actually bind to the molecules and move them across the membrane. In either case transport proteins are very specific.

Passive Transport

You might be interested in
During the process of gene expression, what is the role of the ribosome?
tester [92]

Answer:

fijti[oto2oj4ttblijtbiu[tru3

Explanation:

bij5itj]3i]hi5i[2

7 0
3 years ago
Rank the following people in regards to the percentage of water in their body composition (assume that they are all healthy indi
lozanna [386]

Answer:

Lowest 85year old male; 56%range of 47 to 67 %.

45 year old male ;59% range of 43 to 73%.

23 year old female 50% range of 41 to 50%.

Highest in infants with percentage of 74% ranges of 64 -84%.

Based on body organs the lungs has the heighest water storage of 83 %,

79% in muscles and kidmey

,followed by the heart and brain of 73%,

skin 64% and bones has the lowest 31%.

Explanation:

8 0
3 years ago
Hii everyone i have question again which substances made gages​
slamgirl [31]

What is the question???

8 0
3 years ago
It is found that many insecticides - used to kill insects - lose their effectiveness after some years. What could be the cause o
Mrac [35]

Answer:

C) The insects develop resistance to the insecticide, which is passed on to successive generations.

Explanation:

It's called adaptation.

4 0
3 years ago
Read 2 more answers
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
Other questions:
  • Which statement is true about a scientific theory?
    12·1 answer
  • Presence of a synovial cavity, articular cartilage, synovial membrane, and ligaments are characteristics of what type of joint?
    10·1 answer
  • Which is represented by the arrow labeled 1 in the diagram?
    10·1 answer
  • Which scientific area is a major force in shaping modern classification methods? physiology anatomy evolution behavior regions
    6·1 answer
  • List three potential benefits of the selective breeding of animals, such as cattle and goats.
    6·1 answer
  • 7 point
    13·1 answer
  • The sides of the DNA ladder are made of two molecules that alternate. The alternating molecules are __?__ and __?__.
    13·1 answer
  • How many total carbonate ions would be present in the formula for aluminum carbonate?
    7·1 answer
  • What evidence suggests that birds evolved from theropod dinosaurs?
    5·1 answer
  • Which best defines cohesion?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!