1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
3 years ago
13

Explain what causes seasons on Earth by filling in the blanks.

Geography
2 answers:
marin [14]3 years ago
4 0
The first slot is tilt
The second one is rotation
And the last one would be Summer
denpristay [2]3 years ago
3 0
Hello how is your day today
You might be interested in
Use the drop-down menus to identify the type of mass movement in each image.
hoa [83]
Slump
mudflow
landslide
7 0
3 years ago
Read 2 more answers
How to survive the zombie apocalypse Global Studies Maps homework? I really need help
Gwar [14]
Have food weapons and shelter ^_^
8 0
3 years ago
What is the largest lake in Central Europe?
Slav-nsk [51]

Answer:

The largest lake in Central Europe is Lake Balaton

3 0
3 years ago
Why do some large commercial airlines fly in the stratosphere? ​
aivan3 [116]

Answer:

-Commercial jet aircraft fly in the lower stratosphere to avoid the turbulence which is common in the troposphere below. The stratosphere is very dry; air there contains little water vapor. Because of this, few clouds are found in this layer; almost all clouds occur in the lower, more humid troposphere.

6 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • How has local consumers been affected by imports of clothing and goods at cheap prices?
    9·2 answers
  • Truth or false... all tectonic plates are the same??
    13·2 answers
  • Which region of the early universe was most likely to become a galaxy? which region of the early universe was most likely to bec
    5·2 answers
  • You are dropped off by helicopter at a site on the land. You are told that it is a plate boundary. Almost immediately, you feel
    13·1 answer
  • C 24.5
    14·1 answer
  • Where is garo hills ?????????​
    11·1 answer
  • Why does NATO consider Russia an enemy?​
    12·1 answer
  • Which temperature mode is best for a thermostat, auto mode.
    6·1 answer
  • If the front of an active glacier is observed to be stationary, it is correct to infer that the ice in the glacier is
    15·1 answer
  • where does the sand on our beaches in california primarily originate from? group of answer choices granites of the sierra-nevada
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!