I believe a diet of 2,000 calories is used.
Hope that helped you.
The answer is: How quickly do rats reproduce?
Answer:
D. Planting exotic shade plants in their yard and hiring a lawn company to tend to them.
Explanation:
Both grass and vegetables produce CO2. Vegetables produce as much CO2 as a car that's been driving 4.5 miles. Beef produces enough CO2 for 63 miles. This eliminates all of the answers except for D. Plants use CO2 in photosynthesis and give off O2. So not only will is reduce the CO2 output, it will provide you oxygen.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
DNA?, because everyone’s DNA is unique and different in its own way