1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
3 years ago
8

PLEASE HELP, YOU WILL GET BRAINLIEST! A mutation can only be inherited if it occurs in what type of cell?

Biology
2 answers:
SVEN [57.7K]3 years ago
8 0

Answer:

Germ cell DNA

Explanation:

it said my answer had to be 2p characters long

tangare [24]3 years ago
6 0

Answer:

Hereditary mutations can only occur in sperm cells or germ cells.

You might be interested in
What kind of matter if formed when atoms of two or more elements bond
Y_Kistochka [10]
The answer is Compound 
7 0
3 years ago
Read 2 more answers
What global climatic change gave gymnosperms an advantage over ferns?
luda_lava [24]

Answer:

it is D

What global climatic change gave gymnosperms an advantage over ferns?

A) Increased fluctuations in global climate

B) the climate becoming hotter and wetter

C) the climate becoming cooler and drier

D) the climate becoming hotter and drier

4 0
3 years ago
PLS HELP Due in 20 minutes
garri49 [273]
The first one is to absorb calcium.

second question: I THINK poor wound healing
7 0
2 years ago
Read 2 more answers
HELP PLZ GOD BLESS YOU AND YOUR GRADES
iren [92.7K]

Answer:

The third and second is the  correct!

Explanation:

For example, cooling water will cause it to become ice.

As for the second one, if you heat up liquid, the particles move faster, causing the liquid to evaporate and become a gas

Hope i helped! :3

had a brain fart, sorry, i fixed it

8 0
3 years ago
Describe the factors that affect saturation of water and the relative humidity in air
joja [24]

Answer: is the ratio of the partial pressure of water vapor to the equilibrium vapor pressure of water at a given temperature. Relative humidity depends on temperature and the pressure of the system of interest. The same amount of water vapor results in higher relative humidity in cool air than warm air. A related parameter is the dew point.

Explanation:

6 0
3 years ago
Other questions:
  • Please help
    15·1 answer
  • Which of the following plant science roles involves the largest number of people?
    5·2 answers
  • A reduction in the lateral angle of the glenohumeral joint in relation to the anatomical position would be called __________. a.
    10·1 answer
  • Explain how the nucleus Observed in cheek cell​
    6·2 answers
  • Explain what the relationship between soils and acid deposition is?
    13·1 answer
  • it is recommended for most adults that carbohydrates make a 45 through 65% of their diet, proteins make up 10 to 35% of their di
    5·2 answers
  • How do wales differ from fish
    8·2 answers
  • Name the three white poisons which should be eliminated ( but I'm addicted to...):-P​
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • In one or two sentences, explain how a disease that harms the roots of a flowering plant would affect the plant's ability to sur
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!