1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GaryK [48]
3 years ago
9

Understanding how alcohol is absorbed and metabolized by the body can provide helpful insights into the potential effects of alc

ohol.
Please choose the correct statements about alcohol absorption and metabolism.

Select all that apply.

__Alcohol inhibits the release of antidiuretic hormone, which can lead to dehydration.
__Most alcohol is metabolized in the small intestine.
__Alcohol can improve an individual’s sleep.
__Food in the stomach slows the absorption of alcohol.
__Women have about 20 to 30% more alcohol dehydrogenase in their stomachs than men.
Biology
1 answer:
Tasya [4]3 years ago
3 0

Alcohol do decrease the release of Antidiuretic hormone. Its absorption is also slowed down by amount of food in stomach.

Option A and D.

<h3><u>Explanation:</u></h3>

Alcohol is very much related with decreasing effect on pituitary gland to release the Anti Diuretic Hormone or ADH which is actually responsible for the reabsorption of water through kidneys. So consumption of alcohol may make a person dehydrated.

Its mainly metabolized in liver by the enzyme alcohol dehydrogenase into aldehydes and then into acids which are further metabolized into several products.

Alcohol has a negative effect on REM sleep which is actually the main part of sleep cycle.

Alcohol dehydrogenase is an enzyme which metabolize the alcohol in liver. In females, the amount of alcohol dehydrogenase is less than what is found in males. So they often have alcohol toxicity much faster than males.

You might be interested in
What chemical formula reflects the diagram
Elden [556K]
Chemical formula is a way of presenting information about the chemical proportions of atoms that constitute a particular chemical compound or molecule, using chemical element symbols, numbers, and sometimes also other symbols, such as parentheses, dashes, brackets, commas and plus (+) and minus (−) signs. These are limited to a single typographic line of symbols, which may include subscripts and superscripts. A chemical formula is not a chemical name, and it contains no words. Although a chemical formula may imply certain simple chemical structures, it is not the same as a full chemical structural formula. Chemical formulas can fully specify the structure of only the simplest of molecules and chemical substances, and are generally more limited in power than are chemical names and structural formulas.
5 0
3 years ago
Which element cycles through both photosynthesis and respiration? A magnesium B nitrogen C oxygen or D sodium
34kurt

Pretty sure the answer is oxygen, as it is produced in photosynthesis and consumed in respiration.

7 0
3 years ago
Jena is reading about factors that affect Florida's climate. One sentence reads: Most of Florida is less than 100 feet above sea
Marrrta [24]

<u>Answer:</u>

Jena is reading about the elevation.

<u>Explanation:</u>

  • Elevation is the altitude (height) above the sea level. The Florida being at the height of less than 100 feet is its elevation.
  • The major factor that affects the climate of that region is its elevation.as the elevation increases i.e. the height of the place from sea level increases the temperature of that place lowers.
  • For every 1 kilometer rise in elevation the temperature decreases by 6.5 degree Celsius. Hence, Jena is concerned about the elevation.
4 0
3 years ago
Which nutrition tip would you not recommend?
Julli [10]

Answer:

b. It is recommended to go long periods of time without eating to loose weight.

Explanation:

Spending long periods of time without eating is not the right thing to do when you want to lose weight. Spending too much time fasting does not guarantee weight loss, and causes serious illnesses that threaten, among other things, the heart.

A recent survey by nutritionist Roberta Cassani of the Institute of Nutrition in Itu, São Paulo state, shows that the greater the number of hours without putting anything in the mouth, does not help anyone lose weight, on the contrary, fasting causes the increase of the circumference of the abdomen.

According to the scientist, the main reason that prolonged fasting is an enemy of the waist is that the meal set up after this period of scarcity is usually an example of caloric and nutritional imbalance - in the research, fasting usually occurred in the afternoon. “When they have access to food, the greedy individual does not make healthy choices,” explains the expert. Being deprived of energy, the body triggers a whole mechanism that favors the binge eating, the result is that the individual gets fat.

8 0
3 years ago
A population of deer mice with light-colored coats lives in Sand Hills, Nebraska. The ground in Sand Hills is light colored wher
tatyana61 [14]
Light-colored coats were selected for on light colored sand
6 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP WILL GIVE BRAINLIEST TO CORRECT ANSWER
    8·2 answers
  • Why is fishing for some kinds of ocean fish controlled by laws?
    13·1 answer
  • How does dna help with the transfer of genetic material from parents to offspring? proteins bind to dna, which activates them an
    12·2 answers
  • The stage during which a prenatal child can open and close its eyes and can cry is the
    11·1 answer
  • HELP ME ASAP
    14·2 answers
  • Which of the following best explains how introducing an invasive plant species to an ecosystem would affect the ecosystem over a
    7·2 answers
  • Identify each of the organic compounds based on their structure and also provide their monomers and
    7·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • 4 Which muscles are actively involved in normal breathing?
    5·2 answers
  • Which structure encloses a human cell and controls the traffic of molecules in and out of the cell?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!