It would be Carbon Dioxide.
The answer is Psychoneuroimmunology.
This is the study pf the interactions among behavioral, neural and endoicrine, and immune processes. The brain communicates with the immune system through the autonomic nervous system and neuroendocrine activitry.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The correct answer is - Friction occurs irrespective of the state of the matter.
Explanation:
Friction is the force that takes place when there are two different surfaces slide or moves across one another and causes a resistance between surfaces. The friction always takes place opposite direction to the other surface direction of moving.
Pushing a book on a table, pulling a heavy cart on road all are examples of friction. The friction that occurs in liquids and gases is called fluid friction. Thus, the friction takes place irrespective of the state of the matter.
