1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
11

Write one paragraph discussing how gasoline affects humans,animals and plants.

Biology
1 answer:
Tpy6a [65]3 years ago
7 0
There lungs have a big impact with the gasoline situation it has a very toxic smell and is bad if it’s mixed in with the air molecules.
You might be interested in
Alcohol works as a central nervous system depressant by:
kirza4 [7]
Alcohol works as a central nervous system depressant by <span>binding to neuron receptors.
</span>Alcohol<span> can </span>affect badly on many<span> parts of the brain, it can contracts brain tissues and destroys brain cells, it also depresses the </span>central nervous system, so Alcohol is bad for health but instead of this people drink Alcohol a lot and when a person drink alcohol in excess amount<span> over a prolonged period of time that can cause serious problems with cognition and memory.</span>
8 0
3 years ago
As materials move from higher to lower concentration what is occurring
Akimi4 [234]
As materials move from higher to lower concentration diffusion is occurring.
8 0
3 years ago
A ____________________ is an organized profile of a person’s chromosomes.
mariarad [96]

Answer:

karyotype

Explanation:

3 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
The piece of RNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5′-GUUU
Otrada [13]

Answer: B) Arginine

Explanation: Having the sequence (mRNA):

5′-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3, we can go through the following procedure:

1. Identifying the binding site for the initiator tRNA, which is the so-called "start codon" AUG: 5′-GUUUCCCGUAUAC<u><em>AUG</em></u>CGUGCCGGGGGC-3′

2. Look for the next codon after AUG, which is CGU:

5′-GUUUCCCGUAUACAUG<u><em>CGU</em></u>GCCGGGGGC-3

3. Look in a codon table in which amino acid corresponds to CGU. Then you will find that amino acid is Arginine.

The reason you should follow the above procedure is that during translation, ribosomes are in charge of creating a new peptide bond from mRNA using different tRNA. A tRNA is a structure with a codon attached to it and an amino acid. If a tRNA has a UAC codon attached to it, then this tRNA is going to scan the mRNA looking for the corresponding AUG (the so-called start codon). This is why the tRNA with the UAC codon attached to it is called "initiator tRNA". When initiator tRNA finds the start codon, the large subunit of the ribosome would place this tRNA plus mRNA in its so-called P site (Polypeptide site). On the right of the P site is the A site (Amino acid site) which will be waiting for the tRNA which attached codon corresponds to the next codon after the start codon AUG in the mRNA. For this case, that codon which A site is waiting for is CGU, which is attached to a tRNA containing the corresponding amino acid which is Arginine.

3 0
3 years ago
Other questions:
  • I NEED ASAP ( 30 POINTS )
    13·2 answers
  • DNA strands are held together by hydrogen bonds. What characteristic of hydrogen bonds make them work well during DNA replicatio
    7·1 answer
  • which living organisms is crucial to ensuring the nitrogen gas from the air becomes available as a nutrient for living things?
    8·1 answer
  • All characteristics to animals
    11·1 answer
  • Stickleback fish are collected from a lake in Alaska. 600 from the sample are spineless, which is a recessive trait in the fish.
    14·1 answer
  • the scientific method is used by scientists to explain a certain natural phenomenon, and it involves the formation of a ______ a
    10·1 answer
  • __________ are secreted by cells infected with viruses, alerting neighboring cells and protecting them from becoming infected.
    10·1 answer
  • Will mark brainliest!!
    13·1 answer
  • What information can be obtained from the number of colonies obtained on a plated medium?
    14·1 answer
  • In the completed punnet square what percentage of the off spring are homzygous recessive
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!