1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
6

Based on the chart, Which system interactions are dependent on the plant's ability to respond to the direction of

Biology
1 answer:
Rashid [163]3 years ago
4 0
O answer is A. I bet
You might be interested in
See the picture to help you. Its what you use to answer the question.
zhannawk [14.2K]
I would have to say d.Please let me know if i am right.

5 0
4 years ago
Read 2 more answers
How are mosquitoes involved in the spread of malaria
serg [7]
Malaria is spread by mosquitoes because females pick up a parasite and when they bite someone to nurture their eggs it spreads
4 0
3 years ago
Read 2 more answers
Design a healthy diet for a growing body, what food groups would you include and why. Explain in detail what you get from each f
____ [38]

Here is a good resource:

https://nhlbi.nih.gov/health/educational/lose_wt/eat/calories.htm



5 0
3 years ago
How do organ cultures differ from cell cultures?
Over [174]

They can keep organ tissue alive for transplantation.

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Genetic drift can best be defined as
    7·2 answers
  • How is sunlight used in photo synthesis
    8·2 answers
  • 3. Which earthquake scale takes into consideration the damage caused by an earthquake? A. Modified Mercalli scale B. Moment magn
    5·1 answer
  • Which blood test is performed to measure the level of glucose after the patient has not eaten for at least 12 hours?
    10·1 answer
  • The platypus is the only living member of the family Ornithorhynchidae.
    15·1 answer
  • A measurement that determines how often the allele (gene variant) expression of a particular gene arises in a population and is
    8·1 answer
  • Based on the weather map seen here, what kind of weather conditions should we expect in Memphis?
    14·2 answers
  • Find out which animal is actually most closely related to the hawk: shark, bat, or alligator. Report your findings and explanati
    10·2 answers
  • Organs combine to form _________.
    11·1 answer
  • The list shows some of the livestock being raised in South Dakota.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!