1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
3 years ago
8

Four students provide their teacher with an explanation of why photosynthesis is considered a chemical change. Luke: Photosynthe

sis is considered a chemical change because the CO2 molecules disappear and the O2 molecules reappear. Jackie: I know that photosynthesis is a chemical change because all of the reactants undergo a state of matter change and are all present as a product. Tara: Through photosynthesis, the CO2 and water are changed into new substance, glucose, therefore it is considered a chemical change. Skyler: Photosynthesis is a chemical change because solar energy is required. Which student provides the best explanation of why photosynthesis is a chemical change
Biology
1 answer:
kenny6666 [7]3 years ago
6 0

Answer:

The best explanation was provided by the student Tara who said: "Through photosynthesis, the CO2 and water are changed into new substance, glucose, therefore it is considered a chemical change".

Explanation:

A chemical change is one which is not easily reversible and which results in the formation of new subsatances.

For example, in photosynthesis,a new substance, glucose is formed from the original substansubstances, carbon dioxide and water. Also, the reverse process of the formation of carbon dioxide and water from glucose is not easily obtained in plants.

From explanations provided by the students :

Luke does not give any explanation of the process but only an observation

Jackie's explanation does not state the main reason why a chemical change differs from a physical one.

Tara, gives the best explanation as the reason why a change that occcured is a chemical change is clearly stated.

Skyler does not state the main reason why photosynthesismis a chemical change as well, because even physical changes like evaporation of water involves solar energy.

You might be interested in
Type the correct answer in each box. The atomic number of sodium (na) is 11. The element phosphorous(p) is the fourth element to
alexgriva [62]

Answer:

The atomic number of phosphorus is 15. It has zero charge because it has 15 electrons.

7 0
3 years ago
Which of these is true for bacteria because they are prokaryotic cells
PtichkaEL [24]
A is tha answer i think
3 0
4 years ago
In what type of circulation does the oxygenated blood flow between the heart and the cells of the body
arlik [135]
Systematic circulation
6 0
3 years ago
Which process helps gas exchange to occur?
Vilka [71]
Respiration is a process of exchanging gas.
6 0
4 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Some people see wind energy as a clean alternative to fossil fuels. Others believe that utilizing this renewable energy resource
    10·1 answer
  • How much force is needed​ to lift a 25 kg mass?
    8·1 answer
  • Please help me with this problem
    12·1 answer
  • 10pts 5 stars and a thanks if right, 1 star if wrong
    14·1 answer
  • Which explains how the greenhouse effect and greenhouse gases can cause problems with earth’s energy budget?   A. The more green
    6·1 answer
  • What is the primary goal of human communities?
    10·1 answer
  • Help me with this, and i will mark brainliest
    5·1 answer
  • What is a compound eye?
    14·1 answer
  • Offspring inherit _________________; if one or both parents passes on a gene with DNA that does not code for functional proteins
    7·1 answer
  • dynamic modeling of alpha-synuclein aggregation for the sporadic and genetic forms of parkinson's disease
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!