1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
5

Which of the following statements best describes the function of a

Biology
1 answer:
Amiraneli [1.4K]3 years ago
6 0

Answer:

C. The inhibitor binds to the enzyme's active site, because its shape is similar to that of the substrate.

Explanation:

An enzyme can be defined as a biological catalyst that typically lowers the activation energy of a biological reaction. When the activation energy of a reaction is low, the rate of the reaction would be faster. Therefore, an enzyme speeds or catalyzes the rate of a reaction by lowering its activation energy. Also, if the conditions are not optimal for an enzyme, it limits the ability of an enzyme to bind or be joined with its substrates.

Generally, enzymes function best at a specific pH and temperature level. An increase in temperature increases or speeds up the rate of a reaction while low temperature limits or reduces the rate of a reaction. The optimal temperature for enzymes in the human body is around 37 degrees celsius.

An allosteric effector can be defined as an agent, organ or molecule that is being binded to an enzyme at a site, thereby causing a reduction (negative effect) or an increase (positive effect) in an enzyme activity.

An inhibitor is any substance that slows down or stops a biological process or chemical reaction.

Hence, the statement which best describes the function of a competitive inhibitor in an enzyme-catalyzed reaction is that the inhibitor binds to the enzyme's active site, because its shape is similar to that of the substrate and consequently, slowing down or stopping the process.

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is most likely a source of air pollution
slamgirl [31]

Answer:

This is easy, CO2 is (Carbon Dioxide) a main cause of air pollution. We put it in the air every day when we drive cars or vehicles. And from wildfires and volcanoes, but they rarely erupt now.

Explanation:

4 0
2 years ago
Read 2 more answers
Gluconeogenesis occurs in the liver due to the action of ________.
Wewaii [24]
I believe it is D) Cortisol
3 0
3 years ago
What is it called when a string of islands that forms where two convergent boundaries collide?
just olya [345]

When two convergent boundaries collide, especially in the ocean, an Island arc is formed.

When these  two convergent plates collide, the older plate which is denser subducts beneath the younger plate.  As the subducting plate is pushed deeper into the mantle, it melts. The magma this creates rises and erupts. This forms a line of volcanoes known as an island arc , with considerable earth quakes created.

Examples of island arcs include Japan, Indonesia, the Phillipine Islands and the Aleutian Islands  of Alaska.



7 0
3 years ago
An atom with 9 protons and 8 electrons is what kind of atom?
Reika [66]

Answer:

B. A cation

Explanation:

An atom is the smallest indivisible component of a matter including an element. An atom contains three particles called SUBATOMIC PARTICLES (PROTON AND NEITRON in the nucleus and ELECTRON surrounding the nucleus). The proton is positively charged while the electron is negatively charged.

The number of protons and electrons determine whether an atom will be postively charged (cation) or negatively charged (anion). In this question, an atom with 9 protons and 8 electrons will be A CATION because the protons (9) are more than the electrons (8), hence, making it a positively charged atom (cation).

N.B: The cation atom will have a +1 charge

7 0
4 years ago
Other questions:
  • Sexual reproduction leads to offspring that are all genetically different from one another and from either parent. what are the
    8·1 answer
  • When two experiments are identical except for one variable, the experiment is called a(n) _____. controlled experiment variable
    15·1 answer
  • What are the levels of ecology, from the smallest level to largest level?
    14·1 answer
  • Select all that apply. For the photosynthesis process to occur, a plant needs _____. sunlight chlorophyll nitrogen carbon dioxid
    6·1 answer
  • "curdling of milk". it is a chemical change or a physical change? give reason?​
    15·1 answer
  • Where do the respiratory and circulatory systems meet?
    9·1 answer
  • The respiratory systems of birds are very efficient at providing oxygen to the blood, which is necessary for birds to expend the
    5·1 answer
  • Which organism reproduces through budding?<br> O sponges<br> O bacteria<br> O animals<br> O fungi
    15·1 answer
  • I don’t know the answer so I need help,yeah,I’m confuse like you
    13·1 answer
  • Another source for sulfur is from pollution cases by man-made activities. These are mixed with water in the air falling in
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!