1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
3 years ago
5

What is evolution???

Biology
1 answer:
Feliz [49]3 years ago
6 0
Evolution is change in the heritable characteristics of biological populations over successive generations
You might be interested in
"Response to stimulus" refers to
alina1380 [7]

Answer:

C. the behavior of an organism in a particular situation

5 0
3 years ago
Read 2 more answers
What does it mean that earlobe attachment is a continuous trait?​
mylen [45]

Answer:

If you decided that the continuous spectrum of earlobe shape was a more accurate way to describe the variation, you aren’t alone. Family and genetic studies show that earlobe attachment is actually not a simple trait, but rather a complex trait, affected by multiple genes and environmental factors.

3 0
3 years ago
Which of the following is an order of amphibian?
kaheart [24]
The answer is A. Anura
8 0
3 years ago
What is an outside force that affects the well-being of a living thing?​
Triss [41]

Answer:

gravitational force

Explanation:

Gravitational force is the force responsible for firmness while standing.

3 0
3 years ago
The normal shape of an enzyme is as shown in structure A. If the enzyme's shape changes to that shown in structure B, what are t
Varvara68 [4.7K]

Answer:

There is no image showing the shape of an enzyme, however, the question can still be answered based on basic understanding. The answers are;

- Less binding of substrate

- won't follow the lock-and-key pattern of enzyme binding

Explanation:

An enzyme is a biological catalyst that regulates the rate of chemical reactions in living systems. Enzymes are proteinous in nature and every protein is made up of an amino acid sequence. The amino acid sequence forms a three-dimensional shape that determines the functionality of the enzyme.

Enzymes catalyze reactions by binding to their substrates in a lock and key pattern. This makes enzymes substrate-specific. If the enzyme's normal shape changes, the following will occur:

- Less binding of substrate

- won't follow the lock-and-key pattern of enzyme binding.

8 0
3 years ago
Other questions:
  • What are three kinds of bonds that carbon atoms can form?
    12·1 answer
  • Contours that are spaced evenly represent a ______ slope
    5·2 answers
  • What muscles do you use when you rise up on your toes?
    12·1 answer
  • Predict the Earth Mass (ME) of an exoplanet with an Earth Radius measure of 3.2 RE.
    6·1 answer
  • Will give brainliest PLEASE HELP NOW!!!!
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How do the characteristics<br> of viruses and bacteria<br> compare?
    9·1 answer
  • Four substances are important for both
    7·2 answers
  • Whoever knows how to fill out a taxonomic key Hmu with social media because I really need help
    13·1 answer
  • Water and food are both examples of _____ factors.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!