1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
12

How do some economists refer to natural resources?

Biology
1 answer:
Dmitriy789 [7]3 years ago
7 0
The Answer is All of the above
You might be interested in
How has technology helped reduce the spread of infectious disease?
KATRIN_1 [288]
We can do brain scans and things that help us diagnose sickness
4 0
3 years ago
Which of the following might be a density-independent limiting factor for a group of kangaroo rats?
balandron [24]
The answer is flash floods (:
7 0
3 years ago
A slow environmental change is change that occurs...
STatiana [176]
I believe it would be B. More than a year (Since it is a slow change, and that is the longest amount of time). Hopefully this helps
6 0
3 years ago
Read 2 more answers
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
The extract of which gymnosperm cone is used in weight loss?
goblinko [34]

Answer:

<h2>Ginkgo is the right answer....</h2>

4 0
3 years ago
Read 2 more answers
Other questions:
  • The term _________________ is used to identify a scientist who studies fossils.
    14·1 answer
  • What do microbiologists do?
    15·2 answers
  • Why is a cell membrane so important
    5·2 answers
  • If parent 1 tt crosses with parent 2tt what percentage
    9·1 answer
  • 3.
    6·1 answer
  • A runner is three quarters of the way through a marathon. Which systems are working to maintain oxygen levels for the runner's m
    12·2 answers
  • The most frequently used portal of entry for pathogens is the A) mucous membranes of the respiratory tract. B) mucous membranes
    9·1 answer
  • 1) Two tubes are inoculated from the same tube containing a bacterial culture. The cultures are then transferred every day for t
    13·1 answer
  • Which of the following effectively describes the situation of someone with an inherited predisposition to cancer such a familial
    11·1 answer
  • Specializations of the small intestine that increase its surface area for maximal absorption of nutrients include all the follow
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!