That would be a plant. Like a tree, Flower, Hedge, etc. That is because of Photosynthesis. Photosynthesis is a chemical reaction that makes compounds (glucose) by capturing light from its leaves, and water from its roots.
Hope this helps.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
The only difference is that animals need the raw resources from another source for respiration, while plants usually have the materials for respiration ready as they have produced them in photosynthesis.
