1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
3 years ago
11

What is conduction or the definition of conduction

Biology
2 answers:
sleet_krkn [62]3 years ago
7 0

Answer: Conduction is a mode of heat transfer.

Explanation: Conduction is a mode of transfer of energy usually in the form of heat and/or electricity from one molecule to another within a matter by direct contact. Conduction can take place in solids, liquids, and gases.

Conduction of electricity or electrical current takes place due to the movement of electrically charged particles via a medium.

Gemiola [76]3 years ago
6 0

Conduction is when an object allows electricity to pass through it. Think of something like a wire, coper, and steel. Good luck dude!

You might be interested in
So can anyone name all the types of wave and what category they go in.
Verdich [7]
Your in high school why dont you know im just not going to tell you. you should be embarased
5 0
4 years ago
Which of the following scenarios would provide the best evidence that human traits are a result of lifestyle choices...
vesna_86 [32]
A trait is a characteristic of someone so the answer would be

<span>D. Matt had been naturally right-handed since birth. In high school, he decided to start throwing left-handed after reading that there was a shortage of left-handed pitchers in the major leagues. Matt is now left-handed.</span> 
8 0
3 years ago
Read 2 more answers
_____ clouds indicate possible precipitation
aleksandrvk [35]
I think stratus clouds indicate possible precipitation
5 0
3 years ago
What are 2<br> factors that prevents joints from rubbing and wearing down your bones
inessss [21]
A layer of smooth cartilage at their ends, which cushions the bones and prevents them from rubbing directly against one another. The whole joint is also enclosed in a synovial capsule, which is full of synovial fluid. The synovial fluid acts like the oil in an engine, lubricating the joint and preventing the cartilage from becoming worn down.
8 0
3 years ago
Read 2 more answers
In which parts of the kidney are nephrons located?. . . . A.Renal vein and renal artery. . . . B.Renal pelvis and renal vein. .
Lunna [17]
Answer: C. Medulla and Cortex

The nephrons are found at the cortex-medulla junction. There are what we call as the juxtamedullary nephrons and cortical nephrons referring to their designated locations. The juxtamedullary nephrons are involved in the creation of concentrated urine of a person. 

4 0
3 years ago
Read 2 more answers
Other questions:
  • What results if cells do not respond to the normal mechanisms that control cell division?
    8·1 answer
  • One way that researchers study the effects of trans fats on people's health is by setting up controlled experiments. For example
    8·1 answer
  • Do lipids store genetic information?
    7·1 answer
  • How are plant and animal cells different?
    14·1 answer
  • IN THE FOOD CHAIN,CONCENTRATIONS OF HARMFUL SUBSTANCES MAY INCREASE IN HIGHER LEVELS IN THE FOOD CHAIN IN PROCESS KNOWN AS
    9·1 answer
  • Knowing nothing else,what could the relative age of two rocks tell you about them
    15·1 answer
  • Taxonomy is an organizing science used in _____.
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • All herbivore species are small such as insects and would not be able to have massive muscular bodies.
    13·2 answers
  • which region of the cns integrates the reflexes for micturition, defecation, erection and ejaculation?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!