1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
12

Assume that S. typhi immediately enters the bloodstream from the small intestine. Of the following, which would be the first maj

or organ that bloodborne S. typhi would encounter?
A. Stomach.
B. Pancreas.
C. Large intestine.
D. Liver.
Biology
1 answer:
vampirchik [111]3 years ago
7 0

Answer:

D. Liver.

Explanation:

Blood from the small intestine is taken to the liver. For this reason, we can state that if S. typhi enters the bloodstream through the small intestine, the first organ it would affect would be the liver.

The liver receives blood from the small intestine to be able to remove all toxins or useless substances from this blood and regulate how the distribution of nutrients contained in the blood will be to other parts of the body.

You might be interested in
Number________ is the chloroplast. The chloroplast helps the plant obtain food by__________.Number _____________ is the central
stepan [7]

Answer:

Number <u>3</u> is the chloroplast. The chloroplast helps the plant obtain food by <u>photosynthesis</u>. Number <u>1</u> is the central vacuole. The central vacuole helps a plant maintain its structure by <u>turgor pressure</u>.

8 0
2 years ago
Please help!!! The first menses is called the A. Menarche B.menopause C.climacteric D.emission E.ovulation
Tems11 [23]

Answer:

menarche

Explanation:

8 0
2 years ago
Explain what might happen if the chloroplasts in a cell are not working.
marishachu [46]

Answer:

The plant cell will not produce chloroplasts, and the plant will not be green any more.

Explanation:

Hope this helps!!

8 0
2 years ago
What is the answer to this biology question
Luda [366]
B) X140 is corrects.
5 0
3 years ago
Read 2 more answers
Directions: Write the word TRUE if the statement is correct and if not, underline the word or statement incorrect and correct an
Maru [420]

Answer:It can come from unstable atoms that undergo radioactive decay, or it ... Ionizing radiation can affect the atoms in living things, so it poses a health risk by ... Ionizing radiation comes from x-ray machines, cosmic particles from ... However, as with alpha-emitters, beta-emitters are most hazardous

Explanation:

5 0
3 years ago
Other questions:
  • What structure is formed during the unwinding process of replication?
    15·2 answers
  • Which best explains how Deng Xiaoping modernized industry in China?
    8·2 answers
  • Given the following list of antibiotics and their targets, explain how each stops bacteria without harming human cells. Base you
    9·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • This device can be used to remove most biological agents that enter a house.
    9·1 answer
  • The burning of fossil fuels by cars and factories has most affected the ______________ cycle.
    15·2 answers
  • describe the basic process of evolution by natural selection. Describe the underlying genetic basis and role of the environment
    14·1 answer
  • What does a cell copy in dna replication?
    6·1 answer
  • What formed between Australia and Antartica? What was the result of this?
    13·1 answer
  • Indicater I need the meaning
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!