Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
In which plate boundary two plates move towards each other and collide called convergent plate boundary. And causes devastation. E.g. Earthquake, Vulcanicity. In which plate boundary two plates move in opposite direction and do not collide called divergent plate boundary. Mountain building is the result of this type of plate boundary's action. In transform fault both the plates slide each other and causes fault in the sea floor.
Explanation:
Plate is a rigid and solid crustal block which is mobile in character and found in the asthenosphere in the upper mantle. It prevails in semi liquid and viscous condition where plates move easily. There are seven major plates and twenty minor plates. Plates are of two types. Continental plate and oceanic plate.
Where two plates collide with each other that area is known as plate boundary and the edge of plate is known as plate margin. Plate boundary is of three types: Convergent, divergent and transform plate boundary. These are also known as constructive, destructive and neutral plate boundaries.
Answer:
The decline in Japan's fertility rate has been attributed to several factors such as changing lifestyles, people marrying later in life or not marrying at all, and the economic insecurity of younger generation. Increasing life expectancy is another driving force behind the aging trend.
-(thediplomat)
