No it’s the other way around .
RNA is much shorter than DNA. DNA contains the code for making lots and lots of different proteins. Messenger RNA contains the information to make just one single polypeptide chain - in other words for just one protein, or even just a part of a protein if it is made up of more than one polypeptide chain.
Answer:
pets can help boost your mood
Explanation:
if you do not have any pets you could have slight depression if there is no one to cheer you up such as your companion
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Explanation:
Scientific laws and scientific theories are very similar.
They both discuss and observe phenomena that have already occurred and been evaluated.
The main difference between the two is that law defines nature and what it does conditionally, and the reaction of nature when these conditions encounter.
To sum it up, law discusses the behavior of something that transpires in many annotations.
A theory on the other hand discusses not the behavior, but the functions. The “why” factor so to speak.
Explanation:
Pulmonary Arteries where the blood is re-oxygenated.