1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
11

According to the law of conservation of mass, which statement is true?

Biology
1 answer:
Scorpion4ik [409]3 years ago
5 0

Answer:

3 Mass can neither be created nor destroyed.

Explanation:

Not number 1 because The law of conservation of mass states that mass in an isolated system is neither created nor destroyed by chemical reactions or physical transformations. Not 2 One of these is called the law of conservation of mass , which states that during a chemical reaction, the total mass of the products must be equal to the total mass of the reactants.   not 4 go back to number 1 and look why so its 3

You might be interested in
Why is dna smaller than rna?
Elis [28]
No it’s the other way around .

RNA is much shorter than DNA. DNA contains the code for making lots and lots of different proteins. Messenger RNA contains the information to make just one single polypeptide chain - in other words for just one protein, or even just a part of a protein if it is made up of more than one polypeptide chain.
7 0
2 years ago
Read 2 more answers
How do your pets enhance your life? If you do not have any pets, how do you envision a pet would enhance your life?
deff fn [24]

Answer:

pets can help boost your mood

Explanation:

if you do not have any pets you could have slight depression if there is no one to cheer you up such as your companion

4 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
How is a scientific law different from a scientific theory?
Digiron [165]

Explanation:

Scientific laws and scientific theories are very similar.

They both discuss and observe phenomena that have already occurred and been evaluated.  

The main difference between the two is that law defines nature and what it does conditionally, and the reaction of nature when these conditions encounter.

To sum it up, law discusses the behavior of something that transpires in many annotations.  

A theory on the other hand discusses not the behavior, but the functions. The “why” factor so to speak.    

5 0
2 years ago
Deoxygenated blood travels to the lungs through the.
NARA [144]

Explanation:

Pulmonary Arteries where the blood is re-oxygenated.

7 0
2 years ago
Other questions:
  • Plant reproduction by tissue culture differs from reproduction by meristem culture because
    8·1 answer
  • What was the main function of the protocells fatty acid membrane
    5·1 answer
  • Dietary fiber may play a role in the prevention of
    14·1 answer
  • What is the Thin layer around the earth in witch all living organisms exist
    5·1 answer
  • An organism that has the ability to maintain an internal temperature suitable for life
    11·1 answer
  • What do all prokaryotes and eukaryotes have in common ?
    8·2 answers
  • Which of the following correctly identifies active transport?
    14·1 answer
  • Which of the following is a part of a land-based carbon cycle?
    7·1 answer
  • Senescence __________. Question 5 options: a) begins at the moment of conception and accelerates after age 40 b) occurs across a
    7·1 answer
  • Homeostasis refers to:
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!