1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
2 years ago
13

Which of the following structures is associated with sexual reproduction?

Biology
1 answer:
Tresset [83]2 years ago
5 0
I think it’s bulbs (I might be wrong)
You might be interested in
During which period did mammals first appear? A. Pleistocene B. Carboniferous C. Cretaceous D. Jurassic
Sloan [31]
D JURASSIC PERIOD BECAUSE THEY CAME UP WHEN DINOSAURS CAME
7 0
3 years ago
Read 2 more answers
Which of the following is NOT a sex cell?<br><br>A) Sperm<br>B) Egg<br>C) Skin Cell<br>D) Gamete​
belka [17]

Answer:

hlo buddy

.ur answer is (c) skin cell

7 0
2 years ago
Read 2 more answers
Which factor is least likely to affect the results and interpretation of a functional MRI?
Rudiy27
The answer is C. sprained ankle 100%
5 0
3 years ago
Read 2 more answers
What molecule provides immediate energy
bagirrra123 [75]
Idk sorry lol lol lol lol
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • 2. Which of the following can survive either with oxygen or without it?
    6·2 answers
  • Help me please thanks
    8·2 answers
  • Which epithelial tissue is shaped like a column
    5·2 answers
  • The antiparallel arrangement within DNA molecules refers to Select one:
    14·1 answer
  • NE is a water-soluble molecule that acts as a hormone or neurotransmitter depending on what cell it is released from. The bindin
    6·1 answer
  • How does the chance of a coin landing on each side compare to the chance that a gamete cell will receive a particular gene at me
    10·2 answers
  • a. What are the two genotypes of the grandparents? ________ b. What is the genotype of Jane's husband? ________________ c. What
    6·1 answer
  • An atom has 17 protons,16 neutrons and 17 electrons. What is it’s atomic number
    9·2 answers
  • The enzyme glucose 6-phosphate dehydrogenase catalyzes the first step of the Pentose Phosphate Pathway (we will study this pathw
    14·1 answer
  • How can Natural selection account for the long snout of an anteater?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!