1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
3 years ago
11

HELP ME PLEASE ITS AN EMERGENCY

Biology
1 answer:
Fofino [41]3 years ago
8 0

Answer13.4w

Explanation:

You might be interested in
What explanation accounts for the formation of sunspots?
Harman [31]

Answer:

The curvature of the magnetic fields near the sun's equator creates pockets of the photosphere that aren't warmed by convection.

Explanation:

Hope it helps!

6 0
3 years ago
Read 2 more answers
Can mRNA coding for a protein destined to be embedded in the plasma membrane associate with rough ER prior to the initiation of
Debora [2.8K]

Answer:

mRNA must start membrane protein in the cytoplasm and, after that, continue it in the rough ER.

Explanation:

Protein synthesis is initiated when mRNA meets a free ribosome, the primary structure for protein synthesis. Ribosomes can be found in the r<em>ough endoplasmic reticulum</em> or floating in the cytosol. They read the mRNA code and add the correct amino acid using transference RNA to build the protein.

The <u>rough endoplasmic reticulum</u> is in charge of the synthesis and transport of the membrane proteins. It is also in charge of the latest protein modifications after transduction. Synthesis of membrane proteins <u>starts in the cytoplasm</u> with the production of a molecule portion known as a signal sequence. This portion leads the synthesizing protein and associated ribosome to a specific region in the Rough endoplasmic reticulum where it continues the protein building.

Membrane proteins are synthesized in the endoplasmic reticulum and <em>sent to the Golgi complex in vesicles</em>, where it happens the final association of carbohydrates with proteins. Finally, protein is transported <em>from the Golgi complex to its final destiny, the membrane. </em>

4 0
3 years ago
If an entire stack of rock layers has been folded, which of these would have occurred most recently?
Anon25 [30]
The top layer will be the most recent
5 0
3 years ago
Read 2 more answers
Which is not true about spermatogenesis? the process takes place in the walls of the seminiferous tubules. mature spermatozoa ar
mixer [17]

 Answer: Spermatogenesis begins at birth and continues throughout a man's life.

The process in which haploid spermatozoa develop from germ cells in the seminiferous tubules of the testis is known as Spermatogenesis. Thus, the process of spermatogenesis start with mitotic division of the stem cells that is located close to the basement membrane of the tubules. However, a mature male gametes known as sperm but it is commonly known as spermatozoa.

4 0
4 years ago
What are some of the ways that animals rely on plants?
love history [14]

Background. Plants and animals depend on one another for survival in all of Earth's many habitats. ...

Pollination. Pollination is necessary for plants to create new seeds. ...

Propagation. Another way that animals help plants is by dispersing their seeds to new territory. ...

Fertilization.

Hpe this helps :3

4 0
3 years ago
Other questions:
  • Why are the interactions of hormones and tissues considered to be feedback mechanisms
    7·1 answer
  • A peacock and a turkey mate, producing a viable but infertile turcock. This is an example of:
    13·1 answer
  • How can the axis help you determine the season that is taking place in the northern hemisphere
    5·1 answer
  • Examine the photograph of a prepared slide of the root cross section. Notice that the section is circular in outline since it wa
    10·1 answer
  • Male sperm and female egg are diploid cells
    15·1 answer
  • Scientists who study forms of marine life that lived more than 200 million years ago usually have to obtain fossils not from the
    12·1 answer
  • The Occlusal refers to what part of the tooth?
    5·1 answer
  • Please answer!! ASAP
    14·1 answer
  • Which biome does this photograph represent?
    12·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!